EMAIL THIS PAGE TO A FRIEND

GRK4

G protein-coupled receptor kinase 4

102 Gene Product Result for
Synonyms: GPRK2L GPRK4 GRK4a IT11
Gene ID:
Human(2868) Summary: This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates the activated forms of G protein-coupled receptors thus initiating its deactivation. This gene has been linked to both genetic and acquired hypertension. [provided by RefSeq, Jul 2008]
Mouse(14772) G protein-coupled receptor kinase 4
Rat(59077) G protein-coupled receptor kinase 4
Zebrafish(560761) G protein-coupled receptor kinase 4
cow(512489) G protein-coupled receptor kinase 4
domestic cat(101086226) G protein-coupled receptor kinase 4
dog(479075) G protein-coupled receptor kinase 4
chicken(422879) G protein-coupled receptor kinase 4
Zebrafish(100330963) G protein-coupled receptor kinase 4
domestic guinea pig(100718627) G protein-coupled receptor kinase 4
naked mole-rat(101720649) G protein-coupled receptor kinase 4
sheep(101122439) G protein-coupled receptor kinase 4
Domestic Rabbit(100351551) G protein-coupled receptor kinase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019497 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019497 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019497 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001004056 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004056 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004056 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_005307 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005307 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005307 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070881 MISSION® esiRNA esiRNA human GRK4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004056 Rosetta Predictions human pricing
NM_001004057 Rosetta Predictions human pricing
NM_182982 Rosetta Predictions human pricing
NM_022928 Rosetta Predictions rat pricing
NM_001080743 Rosetta Predictions mouse pricing
NM_019497 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004056 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304451 predicted 1611
2 SASI_Hs01_00217889 predicted 794
3 SASI_Hs01_00217890 predicted 1598
4 SASI_Hs01_00217891 predicted 1391
5 SASI_Hs01_00217892 predicted 1338
6 SASI_Hs01_00217893 predicted 1576
7 SASI_Hs01_00217894 predicted 1368
8 SASI_Hs01_00217895 predicted 1234
9 SASI_Hs01_00217896 predicted 718
10 SASI_Hs01_00217897 predicted 780
11 SASI_Hs01_00217898 predicted 1246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004057 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304452 predicted 1714
2 SASI_Hs01_00162956 predicted 883
3 SASI_Hs01_00162957 predicted 1692
4 SASI_Hs01_00162958 predicted 1486
5 SASI_Hs01_00162959 predicted 1428
6 SASI_Hs01_00162960 predicted 1666
7 SASI_Hs01_00162961 predicted 1458
8 SASI_Hs01_00162962 predicted 1332
9 SASI_Hs01_00162963 predicted 813
10 SASI_Hs01_00162964 predicted 873
11 SASI_Hs01_00162965 predicted 1340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182982 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371154 predicted 1714
2 SASI_Hs01_00099421 predicted 891
3 SASI_Hs01_00099422 predicted 1686
4 SASI_Hs01_00099423 predicted 1482
5 SASI_Hs01_00099424 predicted 1429
6 SASI_Hs01_00099425 predicted 1668
7 SASI_Hs01_00099426 predicted 1461
8 SASI_Hs01_00099427 predicted 1334
9 SASI_Hs01_00099428 predicted 815
10 SASI_Hs01_00099429 predicted 876
11 SASI_Hs01_00099430 predicted 1342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022928 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115561 predicted 1246
2 SASI_Rn01_00115562 predicted 546
3 SASI_Rn01_00115563 predicted 463
4 SASI_Rn01_00115564 predicted 480
5 SASI_Rn01_00115565 predicted 467
6 SASI_Rn02_00263621 predicted 1725
7 SASI_Rn01_00115567 predicted 406
8 SASI_Rn01_00115568 predicted 560
9 SASI_Rn01_00115569 predicted 1091
10 SASI_Rn01_00115570 predicted 483
11 SASI_Rn01_00115566 predicted 1376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080743 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293603 predicted 633
2 SASI_Mm02_00293604 predicted 608
3 SASI_Mm02_00293605 predicted 632
4 SASI_Mm02_00293606 predicted 687
5 SASI_Mm02_00293607 predicted 612
6 SASI_Mm02_00293608 predicted 589
7 SASI_Mm02_00293609 predicted 737
8 SASI_Mm02_00293610 predicted 679
9 SASI_Mm02_00293611 predicted 608
10 SASI_Mm02_00293612 predicted 746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019497 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324527 predicted 625
2 SASI_Mm02_00324528 predicted 946
3 SASI_Mm02_00324529 predicted 1906
4 SASI_Mm02_00324530 predicted 944
5 SASI_Mm02_00324531 predicted 2110
6 SASI_Mm02_00324532 predicted 1630
7 SASI_Mm02_00324533 predicted 592
8 SASI_Mm01_00149514 predicted 1757
9 SASI_Mm02_00324534 predicted 739
10 SASI_Mm02_00324535 predicted 924
11 SASI_Mm01_00149510 predicted 1258
12 SASI_Mm01_00149511 predicted 1340
13 SASI_Mm01_00149512 predicted 1562
14 SASI_Mm01_00149513 predicted 1064
15 SASI_Mm01_00149515 predicted 1592
16 SASI_Mm01_00149516 predicted 1462
17 SASI_Mm01_00149517 predicted 974
18 SASI_Mm01_00149518 predicted 1204
19 SASI_Mm01_00149519 predicted 1290
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019497
GRK4 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor kinase 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019497.2-1380s21c1
Sequence:CCGGGGGATTTGAAGTACCACATTTCTCGAGAAATGTGGTACTTCAAATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019497.2-1536s21c1
Sequence:CCGGATCATGGACACATCCGAATTTCTCGAGAAATTCGGATGTGTCCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019497.2-1995s21c1
Sequence:CCGGGTAGGAACATCTTGGATATTGCTCGAGCAATATCCAAGATGTTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019497.1-1057s1c1
Sequence:CCGGGCTCCAGAAATTATCAATCATCTCGAGATGATTGATAATTTCTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019497.1-1486s1c1
Sequence:CCGGGAAATCTTCTACGCTGAATTTCTCGAGAAATTCAGCGTAGAAGATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019497.1-483s1c1
Sequence:CCGGCCAAGAAAGTACCTACTTTAACTCGAGTTAAAGTAGGTACTTTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019497.1-43s1c1
Sequence:CCGGGCCCGTCTAGGATTTAACAAACTCGAGTTTGTTAAATCCTAGACGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019497.1-1332s1c1
Sequence:CCGGGCACCCAATATTCAAGGATATCTCGAGATATCCTTGAATATTGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019497
GRK4 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor kinase 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019497.2-1380s21c1
Sequence:CCGGGGGATTTGAAGTACCACATTTCTCGAGAAATGTGGTACTTCAAATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019497.2-1536s21c1
Sequence:CCGGATCATGGACACATCCGAATTTCTCGAGAAATTCGGATGTGTCCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019497.2-1995s21c1
Sequence:CCGGGTAGGAACATCTTGGATATTGCTCGAGCAATATCCAAGATGTTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019497.1-1057s1c1
Sequence:CCGGGCTCCAGAAATTATCAATCATCTCGAGATGATTGATAATTTCTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019497.1-1486s1c1
Sequence:CCGGGAAATCTTCTACGCTGAATTTCTCGAGAAATTCAGCGTAGAAGATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019497.1-483s1c1
Sequence:CCGGCCAAGAAAGTACCTACTTTAACTCGAGTTAAAGTAGGTACTTTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019497.1-43s1c1
Sequence:CCGGGCCCGTCTAGGATTTAACAAACTCGAGTTTGTTAAATCCTAGACGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019497.1-1332s1c1
Sequence:CCGGGCACCCAATATTCAAGGATATCTCGAGATATCCTTGAATATTGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019497
GRK4 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor kinase 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019497.2-1380s21c1
Sequence:CCGGGGGATTTGAAGTACCACATTTCTCGAGAAATGTGGTACTTCAAATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019497.2-1536s21c1
Sequence:CCGGATCATGGACACATCCGAATTTCTCGAGAAATTCGGATGTGTCCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019497.2-1995s21c1
Sequence:CCGGGTAGGAACATCTTGGATATTGCTCGAGCAATATCCAAGATGTTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019497.1-1057s1c1
Sequence:CCGGGCTCCAGAAATTATCAATCATCTCGAGATGATTGATAATTTCTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019497.1-1486s1c1
Sequence:CCGGGAAATCTTCTACGCTGAATTTCTCGAGAAATTCAGCGTAGAAGATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019497.1-483s1c1
Sequence:CCGGCCAAGAAAGTACCTACTTTAACTCGAGTTAAAGTAGGTACTTTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019497.1-43s1c1
Sequence:CCGGGCCCGTCTAGGATTTAACAAACTCGAGTTTGTTAAATCCTAGACGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019497.1-1332s1c1
Sequence:CCGGGCACCCAATATTCAAGGATATCTCGAGATATCCTTGAATATTGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004056
GRK4 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor kinase 4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004056.1-520s1c1
Sequence:CCGGGCAGTCTTTGTGACAAGCAACCTCGAGGTTGCTTGTCACAAAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004056.1-840s1c1
Sequence:CCGGGAATACCAAGAAAGCTCATATCTCGAGATATGAGCTTTCTTGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004056.1-1956s1c1
Sequence:CCGGGCTTTGCCATTAGATCTAGACCTCGAGGTCTAGATCTAATGGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004056.1-666s1c1
Sequence:CCGGCTGTCAATCTTAGATAGATTCCTCGAGGAATCTATCTAAGATTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004056.1-1085s1c1
Sequence:CCGGGCAAAGTAGATTCGTAGTTAGCTCGAGCTAACTACGAATCTACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004056.1-2014s1c1
Sequence:CCGGGCTTCTTCTATAGACTCTTCACTCGAGTGAAGAGTCTATAGAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004056
GRK4 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor kinase 4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004056.1-520s1c1
Sequence:CCGGGCAGTCTTTGTGACAAGCAACCTCGAGGTTGCTTGTCACAAAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004056.1-840s1c1
Sequence:CCGGGAATACCAAGAAAGCTCATATCTCGAGATATGAGCTTTCTTGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004056.1-1956s1c1
Sequence:CCGGGCTTTGCCATTAGATCTAGACCTCGAGGTCTAGATCTAATGGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004056.1-666s1c1
Sequence:CCGGCTGTCAATCTTAGATAGATTCCTCGAGGAATCTATCTAAGATTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004056.1-1085s1c1
Sequence:CCGGGCAAAGTAGATTCGTAGTTAGCTCGAGCTAACTACGAATCTACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004056.1-2014s1c1
Sequence:CCGGGCTTCTTCTATAGACTCTTCACTCGAGTGAAGAGTCTATAGAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004056
GRK4 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor kinase 4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004056.1-520s1c1
Sequence:CCGGGCAGTCTTTGTGACAAGCAACCTCGAGGTTGCTTGTCACAAAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004056.1-840s1c1
Sequence:CCGGGAATACCAAGAAAGCTCATATCTCGAGATATGAGCTTTCTTGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004056.1-1956s1c1
Sequence:CCGGGCTTTGCCATTAGATCTAGACCTCGAGGTCTAGATCTAATGGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004056.1-666s1c1
Sequence:CCGGCTGTCAATCTTAGATAGATTCCTCGAGGAATCTATCTAAGATTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004056.1-1085s1c1
Sequence:CCGGGCAAAGTAGATTCGTAGTTAGCTCGAGCTAACTACGAATCTACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004056.1-2014s1c1
Sequence:CCGGGCTTCTTCTATAGACTCTTCACTCGAGTGAAGAGTCTATAGAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005307
GRK4 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor kinase 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005307.x-542s1c1
Sequence:CCGGACCCGTAACAAAGAACACATTCTCGAGAATGTGTTCTTTGTTACGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005307.x-753s1c1
Sequence:CCGGGCCTACGCTTATGAAACCAAACTCGAGTTTGGTTTCATAAGCGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005307.x-1266s1c1
Sequence:CCGGAGGATGTTACTCACCAAGAATCTCGAGATTCTTGGTGAGTAACATCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005307.x-267s1c1
Sequence:CCGGGAATATGAAGTTGCCGATGATCTCGAGATCATCGGCAACTTCATATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005307.x-1116s1c1
Sequence:CCGGCTTGGCTGTCTGATCTATGAACTCGAGTTCATAGATCAGACAGCCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005307
GRK4 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor kinase 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005307.x-542s1c1
Sequence:CCGGACCCGTAACAAAGAACACATTCTCGAGAATGTGTTCTTTGTTACGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005307.x-753s1c1
Sequence:CCGGGCCTACGCTTATGAAACCAAACTCGAGTTTGGTTTCATAAGCGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005307.x-1266s1c1
Sequence:CCGGAGGATGTTACTCACCAAGAATCTCGAGATTCTTGGTGAGTAACATCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005307.x-267s1c1
Sequence:CCGGGAATATGAAGTTGCCGATGATCTCGAGATCATCGGCAACTTCATATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005307.x-1116s1c1
Sequence:CCGGCTTGGCTGTCTGATCTATGAACTCGAGTTCATAGATCAGACAGCCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005307
GRK4 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor kinase 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005307.x-542s1c1
Sequence:CCGGACCCGTAACAAAGAACACATTCTCGAGAATGTGTTCTTTGTTACGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005307.x-753s1c1
Sequence:CCGGGCCTACGCTTATGAAACCAAACTCGAGTTTGGTTTCATAAGCGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005307.x-1266s1c1
Sequence:CCGGAGGATGTTACTCACCAAGAATCTCGAGATTCTTGGTGAGTAACATCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005307.x-267s1c1
Sequence:CCGGGAATATGAAGTTGCCGATGATCTCGAGATCATCGGCAACTTCATATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005307.x-1116s1c1
Sequence:CCGGCTTGGCTGTCTGATCTATGAACTCGAGTTCATAGATCAGACAGCCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks