EMAIL THIS PAGE TO A FRIEND

GRK5

G protein-coupled receptor kinase 5

Synonyms: GPRK5
UniProtKB ID: P34947, D3DRD0, Q5T059
Gene ID:
Human(2869) Summary: This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates the activated forms of G protein-coupled receptors thus initiating their deactivation. It has also been shown to play a role in regulating the motility of polymorphonuclear leukocytes (PMNs). [provided by RefSeq, Jul 2008]
Mouse(14773) G protein-coupled receptor kinase 5
Rat(59075) G protein-coupled receptor kinase 5
sheep(101107151) G protein-coupled receptor kinase 5
domestic guinea pig(100719009) G protein-coupled receptor kinase 5
naked mole-rat(101718850) G protein-coupled receptor kinase 5
Zebrafish(560806) G protein-coupled receptor kinase 5
cow(281801) G protein-coupled receptor kinase 5
Horse(100065919) G protein-coupled receptor kinase 5
chicken(423929) G protein-coupled receptor kinase 5
domestic cat(101089047) G protein-coupled receptor kinase 5
dog(486915) G protein-coupled receptor kinase 5
113 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
G7546 Anti-GRK5 (491-505) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2108146 Anti-GRK5 antibody produced in rabbit affinity isolated antibody zebrafish, horse, canine, yeast, human, rat, mouse, rabbit, guinea pig, bovine
immunohistochemistry, western blot pricing
SAB2900095 Anti-GRK5 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB2100975 Anti-GRK5 antibody produced in rabbit affinity isolated antibody, lyophilized powder bovine, chicken, zebrafish, yeast, canine, human, rat, rabbit, mouse, horse
western blot pricing
SAB4501286 Anti-GRK5 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
HPA046838 Anti-GRK5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB5201248 Monoclonal Anti-Grk (Pan) antibody produced in mouse clone S145-20, purified immunoglobulin rat, mouse, human
immunocytochemistry, western blot pricing
SAB5201257 Monoclonal Anti-Grk - Alkaline Phosphatase antibody produced in mouse clone S145-20, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing
SAB5201258 Monoclonal Anti-Grk - Apc antibody produced in mouse clone S145-20, purified immunoglobulin mouse, human, rat
immunocytochemistry, western blot pricing
SAB5201249 Monoclonal Anti-Grk - Atto 390 antibody produced in mouse clone S145-20, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5201250 Monoclonal Anti-Grk - Atto 488 antibody produced in mouse clone S145-20, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5201251 Monoclonal Anti-Grk - Atto 565 antibody produced in mouse clone S145-20, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5201252 Monoclonal Anti-Grk - Atto 594 antibody produced in mouse clone S145-20, purified immunoglobulin human, rat, mouse
immunocytochemistry, western blot pricing
SAB5201253 Monoclonal Anti-Grk - Atto 633 antibody produced in mouse clone S145-20, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing
SAB5201254 Monoclonal Anti-Grk - Atto 655 antibody produced in mouse clone S145-20, purified immunoglobulin rat, mouse, human
immunocytochemistry, western blot pricing
SAB5201255 Monoclonal Anti-Grk - Atto 680 antibody produced in mouse clone S145-20, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5201256 Monoclonal Anti-Grk - Atto 700 antibody produced in mouse clone S145-20, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing
SAB5201259 Monoclonal Anti-Grk - Biotin antibody produced in mouse clone S145-20, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5201260 Monoclonal Anti-Grk - Fitc antibody produced in mouse clone S145-20, purified immunoglobulin rat, human, mouse
immunocytochemistry, western blot pricing
SAB5201261 Monoclonal Anti-Grk - Hrp antibody produced in mouse clone S145-20, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5201262 Monoclonal Anti-Grk - Pe/Atto 594 antibody produced in mouse clone S145-20, purified immunoglobulin rat, human, mouse
immunocytochemistry, western blot pricing
SAB5201263 Monoclonal Anti-Grk - Percp antibody produced in mouse clone S145-20, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5201264 Monoclonal Anti-Grk - Rpe antibody produced in mouse clone S145-20, purified immunoglobulin mouse, human, rat
immunocytochemistry, western blot pricing
SAB5201265 Monoclonal Anti-Grk - Streptavidin antibody produced in mouse clone S145-20, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing
WH0002869M2 Monoclonal Anti-GRK5 antibody produced in mouse clone 1D9, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1403879 Monoclonal Anti-GRK5 antibody produced in mouse clone 5E11, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005308 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005308 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005308 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018869 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018869 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018869 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005308 Rosetta Predictions human pricing
NM_030829 Rosetta Predictions rat pricing
NM_018869 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005308 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197540 predicted 788
2 SASI_Hs01_00197541 predicted 776
3 SASI_Hs01_00197542 predicted 1799
4 SASI_Hs01_00197543 predicted 1776
5 SASI_Hs01_00197544 predicted 951
6 SASI_Hs01_00197545 predicted 1968
7 SASI_Hs01_00197546 predicted 1785
8 SASI_Hs01_00197547 predicted 1103
9 SASI_Hs01_00197548 predicted 1686
10 SASI_Hs01_00197549 predicted 2047
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030829 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096413 predicted 429
2 SASI_Rn01_00096414 predicted 338
3 SASI_Rn02_00264035 predicted 1254
4 SASI_Rn01_00096416 predicted 1093
5 SASI_Rn01_00096417 predicted 1026
6 SASI_Rn01_00096418 predicted 1610
7 SASI_Rn01_00096419 predicted 1437
8 SASI_Rn01_00096420 predicted 1629
9 SASI_Rn01_00096421 predicted 1810
10 SASI_Rn01_00096422 predicted 1893
11 SASI_Rn01_00096415 predicted 736
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018869 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142719 predicted 1075
2 SASI_Mm01_00142720 predicted 2565
3 SASI_Mm01_00142721 predicted 1083
4 SASI_Mm02_00324248 predicted 986
5 SASI_Mm01_00142723 predicted 1378
6 SASI_Mm01_00142724 predicted 2539
7 SASI_Mm01_00142725 predicted 2259
8 SASI_Mm01_00142726 predicted 2082
9 SASI_Mm01_00142727 predicted 1732
10 SASI_Mm02_00324249 predicted 1069
11 SASI_Mm01_00142722 predicted 1323
12 SASI_Mm01_00142728 predicted 1746
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005308
VALIDATED
GRK5 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor kinase 5
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010557    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005308.x-2381s1c1
Sequence:CCGGGTGAGACTTTGAGGGTGTATACTCGAGTATACACCCTCAAAGTCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005308.x-1758s1c1
Sequence:CCGGACGAGATGATAGAAACAGAATCTCGAGATTCTGTTTCTATCATCTCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_005308.x-526s1c1
Sequence:CCGGGAAGGAAATTATGACCAAGTACTCGAGTACTTGGTCATAATTTCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005308.x-356s1c1
Sequence:CCGGCGAAGGACCATAGACAGAGATCTCGAGATCTCTGTCTATGGTCCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196900    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005308.2-2244s1c1
Sequence:CCGGGCAATAGAAATCCAATTGGATCTCGAGATCCAATTGGATTTCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195681    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005308.2-2056s1c1
Sequence:CCGGCCTTAGAAGTGGAAGTAGTGGCTCGAGCCACTACTTCCACTTCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005308.2-2264s21c1
Sequence:CCGGTACGACAACTTGCACGTATTTCTCGAGAAATACGTGCAAGTTGTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_005308.2-1804s21c1
Sequence:CCGGTGAACGTGTTTGGACCTAATGCTCGAGCATTAGGTCCAAACACGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_005308.2-695s21c1
Sequence:CCGGGGGAGAACCATTCCACGAATACTCGAGTATTCGTGGAATGGTTCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005308.2-484s21c1
Sequence:CCGGTGGACTCCGTGGCAGAATATGCTCGAGCATATTCTGCCACGGAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005308.2-1189s21c1
Sequence:CCGGTAGATGATTATGGCCACATTACTCGAGTAATGTGGCCATAATCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005308
VALIDATED
GRK5 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor kinase 5
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010557    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005308.x-2381s1c1
Sequence:CCGGGTGAGACTTTGAGGGTGTATACTCGAGTATACACCCTCAAAGTCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005308.x-1758s1c1
Sequence:CCGGACGAGATGATAGAAACAGAATCTCGAGATTCTGTTTCTATCATCTCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_005308.x-526s1c1
Sequence:CCGGGAAGGAAATTATGACCAAGTACTCGAGTACTTGGTCATAATTTCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005308.x-356s1c1
Sequence:CCGGCGAAGGACCATAGACAGAGATCTCGAGATCTCTGTCTATGGTCCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196900    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005308.2-2244s1c1
Sequence:CCGGGCAATAGAAATCCAATTGGATCTCGAGATCCAATTGGATTTCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195681    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005308.2-2056s1c1
Sequence:CCGGCCTTAGAAGTGGAAGTAGTGGCTCGAGCCACTACTTCCACTTCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005308.2-2264s21c1
Sequence:CCGGTACGACAACTTGCACGTATTTCTCGAGAAATACGTGCAAGTTGTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_005308.2-1804s21c1
Sequence:CCGGTGAACGTGTTTGGACCTAATGCTCGAGCATTAGGTCCAAACACGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_005308.2-695s21c1
Sequence:CCGGGGGAGAACCATTCCACGAATACTCGAGTATTCGTGGAATGGTTCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005308.2-484s21c1
Sequence:CCGGTGGACTCCGTGGCAGAATATGCTCGAGCATATTCTGCCACGGAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005308.2-1189s21c1
Sequence:CCGGTAGATGATTATGGCCACATTACTCGAGTAATGTGGCCATAATCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005308
VALIDATED
GRK5 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor kinase 5
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010557    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005308.x-2381s1c1
Sequence:CCGGGTGAGACTTTGAGGGTGTATACTCGAGTATACACCCTCAAAGTCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005308.x-1758s1c1
Sequence:CCGGACGAGATGATAGAAACAGAATCTCGAGATTCTGTTTCTATCATCTCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_005308.x-526s1c1
Sequence:CCGGGAAGGAAATTATGACCAAGTACTCGAGTACTTGGTCATAATTTCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005308.x-356s1c1
Sequence:CCGGCGAAGGACCATAGACAGAGATCTCGAGATCTCTGTCTATGGTCCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196900    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005308.2-2244s1c1
Sequence:CCGGGCAATAGAAATCCAATTGGATCTCGAGATCCAATTGGATTTCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195681    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005308.2-2056s1c1
Sequence:CCGGCCTTAGAAGTGGAAGTAGTGGCTCGAGCCACTACTTCCACTTCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005308.2-2264s21c1
Sequence:CCGGTACGACAACTTGCACGTATTTCTCGAGAAATACGTGCAAGTTGTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_005308.2-1804s21c1
Sequence:CCGGTGAACGTGTTTGGACCTAATGCTCGAGCATTAGGTCCAAACACGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_005308.2-695s21c1
Sequence:CCGGGGGAGAACCATTCCACGAATACTCGAGTATTCGTGGAATGGTTCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005308.2-484s21c1
Sequence:CCGGTGGACTCCGTGGCAGAATATGCTCGAGCATATTCTGCCACGGAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005308.2-1189s21c1
Sequence:CCGGTAGATGATTATGGCCACATTACTCGAGTAATGTGGCCATAATCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018869
VALIDATED
GRK5 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor kinase 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018869.2-353s1c1
Sequence:CCGGCCTGGACTTAGTGGCAGAATACTCGAGTATTCTGCCACTAAGTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018869.2-1224s1c1
Sequence:CCGGCTCATCTATGAGATGATTGAACTCGAGTTCAATCATCTCATAGATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018869.2-513s1c1
Sequence:CCGGCCCTGCAAAGAACTCTTCTCTCTCGAGAGAGAAGAGTTCTTTGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018869.2-1775s1c1
Sequence:CCGGGCAGCATCAAAGCAATTCCAACTCGAGTTGGAATTGCTTTGATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018869.3-1080s21c1
Sequence:CCGGCCTGGACTTAGTGGCAGAATACTCGAGTATTCTGCCACTAAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018869.3-2545s21c1
Sequence:CCGGAGTTGTAACCACCGAATAAATCTCGAGATTTATTCGGTGGTTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018869.3-2400s21c1
Sequence:CCGGGCTGAATGTGTTCGGACCTAACTCGAGTTAGGTCCGAACACATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018869.3-3001s21c1
Sequence:CCGGTCAGACTTTGAGGGTGTATATCTCGAGATATACACCCTCAAAGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018869.3-2304s21c1
Sequence:CCGGGGACCATACGGACGATGATTTCTCGAGAAATCATCGTCCGTATGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018869
VALIDATED
GRK5 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor kinase 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018869.2-353s1c1
Sequence:CCGGCCTGGACTTAGTGGCAGAATACTCGAGTATTCTGCCACTAAGTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018869.2-1224s1c1
Sequence:CCGGCTCATCTATGAGATGATTGAACTCGAGTTCAATCATCTCATAGATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018869.2-513s1c1
Sequence:CCGGCCCTGCAAAGAACTCTTCTCTCTCGAGAGAGAAGAGTTCTTTGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018869.2-1775s1c1
Sequence:CCGGGCAGCATCAAAGCAATTCCAACTCGAGTTGGAATTGCTTTGATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018869.3-1080s21c1
Sequence:CCGGCCTGGACTTAGTGGCAGAATACTCGAGTATTCTGCCACTAAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018869.3-2545s21c1
Sequence:CCGGAGTTGTAACCACCGAATAAATCTCGAGATTTATTCGGTGGTTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018869.3-2400s21c1
Sequence:CCGGGCTGAATGTGTTCGGACCTAACTCGAGTTAGGTCCGAACACATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018869.3-3001s21c1
Sequence:CCGGTCAGACTTTGAGGGTGTATATCTCGAGATATACACCCTCAAAGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018869.3-2304s21c1
Sequence:CCGGGGACCATACGGACGATGATTTCTCGAGAAATCATCGTCCGTATGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018869
VALIDATED
GRK5 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor kinase 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018869.2-353s1c1
Sequence:CCGGCCTGGACTTAGTGGCAGAATACTCGAGTATTCTGCCACTAAGTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018869.2-1224s1c1
Sequence:CCGGCTCATCTATGAGATGATTGAACTCGAGTTCAATCATCTCATAGATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018869.2-513s1c1
Sequence:CCGGCCCTGCAAAGAACTCTTCTCTCTCGAGAGAGAAGAGTTCTTTGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018869.2-1775s1c1
Sequence:CCGGGCAGCATCAAAGCAATTCCAACTCGAGTTGGAATTGCTTTGATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018869.3-1080s21c1
Sequence:CCGGCCTGGACTTAGTGGCAGAATACTCGAGTATTCTGCCACTAAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018869.3-2545s21c1
Sequence:CCGGAGTTGTAACCACCGAATAAATCTCGAGATTTATTCGGTGGTTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018869.3-2400s21c1
Sequence:CCGGGCTGAATGTGTTCGGACCTAACTCGAGTTAGGTCCGAACACATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018869.3-3001s21c1
Sequence:CCGGTCAGACTTTGAGGGTGTATATCTCGAGATATACACCCTCAAAGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018869.3-2304s21c1
Sequence:CCGGGGACCATACGGACGATGATTTCTCGAGAAATCATCGTCCGTATGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks