EMAIL THIS PAGE TO A FRIEND

GRK6

G protein-coupled receptor kinase 6

169 Gene Product Result for
Synonyms: GPRK6
UniProtKB ID: P43250, O60541, Q13652
Gene ID:
Human(2870) Summary: This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates the activated forms of G protein-coupled receptors thus initiating their deactivation. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(26385) G protein-coupled receptor kinase 6
Rat(59076) G protein-coupled receptor kinase 6
Zebrafish(561288) G protein-coupled receptor kinase 6
cow(521413) G protein-coupled receptor kinase 6
Horse(100068570) G protein-coupled receptor kinase 6
domestic cat(101087379) G protein-coupled receptor kinase 6
dog(100684653) G protein-coupled receptor kinase 6
chicken(416361) G protein-coupled receptor kinase 6
domestic guinea pig(100735666) G protein-coupled receptor kinase 6
naked mole-rat(101718249) G protein-coupled receptor kinase 6
sheep(101107019) G protein-coupled receptor kinase 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
G7671 Anti-GRK6 (491-505) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1405890 Anti-GRK6 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1411951 ANTI-GRK6 antibody produced in mouse clone 2G1, purified immunoglobulin, buffered aqueous solution , human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411952 ANTI-GRK6 antibody produced in mouse clone 8B7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411953 ANTI-GRK6 antibody produced in mouse clone 8D9, purified immunoglobulin, buffered aqueous solution , human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411954 ANTI-GRK6 antibody produced in mouse clone 8D4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA018903 Anti-GRK6 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA015327 Anti-GRK6 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB3501085 Anti-GRK6 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4501287 Anti-GRK6, N-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, western blot pricing
SAB1304646 ANTI-MOUSE GRK6 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
WH0002870M1 Monoclonal Anti-GRK6 antibody produced in mouse clone 3B4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403880 Monoclonal Anti-GRK6 antibody produced in mouse clone 2C3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011938 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011938 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011938 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002082 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002082 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002082 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004105 siRNAs that have been validated in the lab human pricing
NM_001004106 siRNAs that have been validated in the lab human pricing
NM_002082 siRNAs that have been validated in the lab human pricing
NM_001112712 Rosetta Predictions rat pricing
NM_001112713 Rosetta Predictions rat pricing
NM_031657 Rosetta Predictions rat pricing
NM_001038018 Rosetta Predictions mouse pricing
NM_001112711 Rosetta Predictions mouse pricing
NM_011938 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004105 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082468 validated 710
2 SASI_Hs01_00082469 predicted 492
3 SASI_Hs01_00082470 predicted 456
4 SASI_Hs01_00082471 predicted 643
5 SASI_Hs01_00082472 predicted 1590
6 SASI_Hs01_00082473 predicted 867
7 SASI_Hs01_00082475 predicted 1118
8 SASI_Hs01_00082476 predicted 882
9 SASI_Hs02_00304469 predicted 1016
10 SASI_Hs01_00082477 predicted 1369
11 SASI_Hs01_00082474 predicted 1575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004106 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229358 validated 705
2 SASI_Hs01_00229359 predicted 493
3 SASI_Hs01_00229360 predicted 450
4 SASI_Hs01_00229361 predicted 649
5 SASI_Hs01_00229362 predicted 1593
6 SASI_Hs01_00229363 predicted 869
7 SASI_Hs01_00229365 predicted 1124
8 SASI_Hs01_00229366 predicted 887
9 SASI_Hs02_00304470 predicted 1013
10 SASI_Hs01_00229367 predicted 1372
11 SASI_Hs01_00229364 predicted 1573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002082 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138784 validated 704
1 SASI_Hs01_00138786 validated 452
2 SASI_Hs01_00138785 predicted 496
3 SASI_Hs01_00138787 predicted 645
4 SASI_Hs01_00138788 predicted 1589
5 SASI_Hs01_00138789 predicted 866
6 SASI_Hs01_00138791 predicted 1118
7 SASI_Hs01_00138792 predicted 881
8 SASI_Hs02_00333161 predicted 1015
9 SASI_Hs01_00138793 predicted 1375
10 SASI_Hs01_00138790 predicted 1567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112712 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251590 predicted 494
2 SASI_Rn02_00251591 predicted 298
3 SASI_Rn02_00251592 predicted 1441
4 SASI_Rn02_00251593 predicted 1259
5 SASI_Rn02_00251594 predicted 555
6 SASI_Rn02_00251595 predicted 714
7 SASI_Rn02_00251596 predicted 810
8 SASI_Rn02_00251597 predicted 745
9 SASI_Rn02_00251598 predicted 891
10 SASI_Rn02_00251599 predicted 1141
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112713 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251600 predicted 498
2 SASI_Rn02_00251601 predicted 303
3 SASI_Rn02_00251602 predicted 1438
4 SASI_Rn02_00251603 predicted 1257
5 SASI_Rn02_00251604 predicted 556
6 SASI_Rn02_00251605 predicted 718
7 SASI_Rn02_00251606 predicted 808
8 SASI_Rn02_00251607 predicted 747
9 SASI_Rn02_00251608 predicted 891
10 SASI_Rn02_00251609 predicted 1144
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031657 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119553 predicted 490
2 SASI_Rn02_00264996 predicted 300
3 SASI_Rn01_00119554 predicted 1437
4 SASI_Rn01_00119555 predicted 1257
5 SASI_Rn01_00119556 predicted 556
6 SASI_Rn02_00264997 predicted 713
7 SASI_Rn02_00264998 predicted 813
8 SASI_Rn01_00119559 predicted 743
9 SASI_Rn02_00264999 predicted 891
10 SASI_Rn02_00265000 predicted 1148
11 SASI_Rn01_00119552 predicted 630
12 SASI_Rn01_00119557 predicted 723
13 SASI_Rn01_00119558 predicted 1509
14 SASI_Rn01_00119560 predicted 1451
15 SASI_Rn01_00119561 predicted 1681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038018 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289583 predicted 338
2 SASI_Mm01_00120201 predicted 1424
3 SASI_Mm01_00120202 predicted 896
4 SASI_Mm02_00289584 predicted 886
5 SASI_Mm02_00289585 predicted 1581
6 SASI_Mm01_00120206 predicted 974
7 SASI_Mm02_00289586 predicted 1611
8 SASI_Mm01_00120209 predicted 907
9 SASI_Mm02_00289587 predicted 1238
10 SASI_Mm02_00289588 predicted 467
11 SASI_Mm01_00120200 predicted 245
12 SASI_Mm01_00120203 predicted 613
13 SASI_Mm01_00120204 predicted 944
14 SASI_Mm01_00120205 predicted 692
15 SASI_Mm01_00120207 predicted 245
16 SASI_Mm01_00120208 predicted 1024
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112711 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306973 predicted 338
2 SASI_Mm02_00306974 predicted 1430
3 SASI_Mm02_00306975 predicted 902
4 SASI_Mm02_00306976 predicted 882
5 SASI_Mm02_00306977 predicted 1575
6 SASI_Mm02_00306978 predicted 974
7 SASI_Mm02_00306979 predicted 1607
8 SASI_Mm02_00306980 predicted 914
9 SASI_Mm02_00306981 predicted 1247
10 SASI_Mm02_00306982 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011938 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321787 predicted 340
2 SASI_Mm01_00063116 predicted 1424
3 SASI_Mm01_00063117 predicted 896
4 SASI_Mm02_00321788 predicted 884
5 SASI_Mm02_00321789 predicted 1581
6 SASI_Mm01_00063121 predicted 976
7 SASI_Mm02_00321790 predicted 1611
8 SASI_Mm01_00063124 predicted 906
9 SASI_Mm02_00321791 predicted 1238
10 SASI_Mm02_00321792 predicted 465
11 SASI_Mm01_00063115 predicted 243
12 SASI_Mm01_00063118 predicted 603
13 SASI_Mm01_00063119 predicted 925
14 SASI_Mm01_00063120 predicted 689
15 SASI_Mm01_00063122 predicted 229
16 SASI_Mm01_00063123 predicted 1019
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011938
VALIDATED
GRK6 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor kinase 6
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011938.3-1616s21c1
Sequence:CCGGGAACAGTTCTCTACAGTTAAACTCGAGTTTAACTGTAGAGAACTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011938.3-483s21c1
Sequence:CCGGGCCGACTAATGCAGAACTTTCCTCGAGGAAAGTTCTGCATTAGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011938.3-861s21c1
Sequence:CCGGCCATGGCTCTCAACGAGAAACCTCGAGGTTTCTCGTTGAGAGCCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011938.1-307s1c1
Sequence:CCGGCGCCGACTAATGCAGAACTTTCTCGAGAAAGTTCTGCATTAGTCGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011938.1-189s1c1
Sequence:CCGGGCGCCTGTTATTTCGTGAGTTCTCGAGAACTCACGAAATAACAGGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011938.1-699s1c1
Sequence:CCGGCGAGAAACAGATCTTGGAGAACTCGAGTTCTCCAAGATCTGTTTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011938.1-68s1c1
Sequence:CCGGGCAAAGGCAAGAGCAAGAAATCTCGAGATTTCTTGCTCTTGCCTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011938
VALIDATED
GRK6 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor kinase 6
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011938.3-1616s21c1
Sequence:CCGGGAACAGTTCTCTACAGTTAAACTCGAGTTTAACTGTAGAGAACTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011938.3-483s21c1
Sequence:CCGGGCCGACTAATGCAGAACTTTCCTCGAGGAAAGTTCTGCATTAGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011938.3-861s21c1
Sequence:CCGGCCATGGCTCTCAACGAGAAACCTCGAGGTTTCTCGTTGAGAGCCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011938.1-307s1c1
Sequence:CCGGCGCCGACTAATGCAGAACTTTCTCGAGAAAGTTCTGCATTAGTCGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011938.1-189s1c1
Sequence:CCGGGCGCCTGTTATTTCGTGAGTTCTCGAGAACTCACGAAATAACAGGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011938.1-699s1c1
Sequence:CCGGCGAGAAACAGATCTTGGAGAACTCGAGTTCTCCAAGATCTGTTTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011938.1-68s1c1
Sequence:CCGGGCAAAGGCAAGAGCAAGAAATCTCGAGATTTCTTGCTCTTGCCTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011938
VALIDATED
GRK6 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor kinase 6
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011938.3-1616s21c1
Sequence:CCGGGAACAGTTCTCTACAGTTAAACTCGAGTTTAACTGTAGAGAACTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011938.3-483s21c1
Sequence:CCGGGCCGACTAATGCAGAACTTTCCTCGAGGAAAGTTCTGCATTAGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011938.3-861s21c1
Sequence:CCGGCCATGGCTCTCAACGAGAAACCTCGAGGTTTCTCGTTGAGAGCCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011938.1-307s1c1
Sequence:CCGGCGCCGACTAATGCAGAACTTTCTCGAGAAAGTTCTGCATTAGTCGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011938.1-189s1c1
Sequence:CCGGGCGCCTGTTATTTCGTGAGTTCTCGAGAACTCACGAAATAACAGGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011938.1-699s1c1
Sequence:CCGGCGAGAAACAGATCTTGGAGAACTCGAGTTCTCCAAGATCTGTTTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011938.1-68s1c1
Sequence:CCGGGCAAAGGCAAGAGCAAGAAATCTCGAGATTTCTTGCTCTTGCCTTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002082
VALIDATED
GRK6 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor kinase 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002082.2-1374s1c1
Sequence:CCGGCGAGGAGTATTCCGAGCGCTTCTCGAGAAGCGCTCGGAATACTCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002082.2-1407s1c1
Sequence:CCGGCCGCTCACTTTGCTCACAGCTCTCGAGAGCTGTGAGCAAAGTGAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195556    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002082.2-2152s1c1
Sequence:CCGGCGAATGTATATAGCGACCAGACTCGAGTCTGGTCGCTATATACATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_002082.2-465s1c1
Sequence:CCGGGCGGCAGCTAACGCAGAATTTCTCGAGAAATTCTGCGTTAGCTGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002082.x-1632s1c1
Sequence:CCGGCTGAATGTCTTTGGGCTGGATCTCGAGATCCAGCCCAAAGACATTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002082.x-551s1c1
Sequence:CCGGCAGCATCTACTTCAACCGTTTCTCGAGAAACGGTTGAAGTAGATGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002082.x-545s1c1
Sequence:CCGGCCTCGACAGCATCTACTTCAACTCGAGTTGAAGTAGATGCTGTCGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002082.x-788s1c1
Sequence:CCGGCAGTAGGTTTGTAGTGAGCTTCTCGAGAAGCTCACTACAAACCTACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002082
VALIDATED
GRK6 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor kinase 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002082.2-1374s1c1
Sequence:CCGGCGAGGAGTATTCCGAGCGCTTCTCGAGAAGCGCTCGGAATACTCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002082.2-1407s1c1
Sequence:CCGGCCGCTCACTTTGCTCACAGCTCTCGAGAGCTGTGAGCAAAGTGAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195556    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002082.2-2152s1c1
Sequence:CCGGCGAATGTATATAGCGACCAGACTCGAGTCTGGTCGCTATATACATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_002082.2-465s1c1
Sequence:CCGGGCGGCAGCTAACGCAGAATTTCTCGAGAAATTCTGCGTTAGCTGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002082.x-1632s1c1
Sequence:CCGGCTGAATGTCTTTGGGCTGGATCTCGAGATCCAGCCCAAAGACATTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002082.x-551s1c1
Sequence:CCGGCAGCATCTACTTCAACCGTTTCTCGAGAAACGGTTGAAGTAGATGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002082.x-545s1c1
Sequence:CCGGCCTCGACAGCATCTACTTCAACTCGAGTTGAAGTAGATGCTGTCGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002082.x-788s1c1
Sequence:CCGGCAGTAGGTTTGTAGTGAGCTTCTCGAGAAGCTCACTACAAACCTACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002082
VALIDATED
GRK6 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor kinase 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002082.2-1374s1c1
Sequence:CCGGCGAGGAGTATTCCGAGCGCTTCTCGAGAAGCGCTCGGAATACTCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002082.2-1407s1c1
Sequence:CCGGCCGCTCACTTTGCTCACAGCTCTCGAGAGCTGTGAGCAAAGTGAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195556    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002082.2-2152s1c1
Sequence:CCGGCGAATGTATATAGCGACCAGACTCGAGTCTGGTCGCTATATACATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_002082.2-465s1c1
Sequence:CCGGGCGGCAGCTAACGCAGAATTTCTCGAGAAATTCTGCGTTAGCTGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002082.x-1632s1c1
Sequence:CCGGCTGAATGTCTTTGGGCTGGATCTCGAGATCCAGCCCAAAGACATTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002082.x-551s1c1
Sequence:CCGGCAGCATCTACTTCAACCGTTTCTCGAGAAACGGTTGAAGTAGATGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002082.x-545s1c1
Sequence:CCGGCCTCGACAGCATCTACTTCAACTCGAGTTGAAGTAGATGCTGTCGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002082.x-788s1c1
Sequence:CCGGCAGTAGGTTTGTAGTGAGCTTCTCGAGAAGCTCACTACAAACCTACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)