EMAIL THIS PAGE TO A FRIEND

GRK7

G protein-coupled receptor kinase 7

32 Gene Product Result for
Synonyms: GPRK7
UniProtKB ID: Q8WTQ7
Gene ID:
Human(131890) Summary: This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. It is specifically expressed in the retina and the encoded protein has been shown to phosphorylate cone opsins and initiate their deactivation. [provided by RefSeq, Jul 2008]
chicken(429125) G protein-coupled receptor kinase 7
cow(281802) G protein-coupled receptor kinase 7
domestic cat(101089290) G protein-coupled receptor kinase 7
dog(485693) G protein-coupled receptor kinase 7
sheep(101106563) G protein-coupled receptor kinase 7
Domestic Rabbit(100350579) G protein-coupled receptor kinase 7
domestic guinea pig(100735580) G protein-coupled receptor kinase 7
naked mole-rat(101726058) G protein-coupled receptor kinase 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139209 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139209 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139209 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139209 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139209 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121067 predicted 1310
2 SASI_Hs01_00121068 predicted 638
3 SASI_Hs01_00121069 predicted 1516
4 SASI_Hs01_00121070 predicted 559
5 SASI_Hs01_00121071 predicted 876
6 SASI_Hs01_00121072 predicted 1032
7 SASI_Hs01_00121073 predicted 941
8 SASI_Hs01_00121074 predicted 690
9 SASI_Hs01_00121075 predicted 1171
10 SASI_Hs02_00364233 predicted 1216
11 SASI_Hs01_00121066 predicted 1431
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139209
GRK7 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor kinase 7
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139209.x-722s1c1
Sequence:CCGGCTGGGAAGATGTATGCCTGTACTCGAGTACAGGCATACATCTTCCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139209.x-1630s1c1
Sequence:CCGGGCATGGCAGGAAGAAATTATACTCGAGTATAATTTCTTCCTGCCATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139209.x-1725s1c1
Sequence:CCGGTGGCGTGTGTTTGTTATTGTACTCGAGTACAATAACAAACACACGCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002406    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139209.x-1781s1c1
Sequence:CCGGCGGCTGACATAATCCTCGAATCTCGAGATTCGAGGATTATGTCAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139209.x-1522s1c1
Sequence:CCGGGCCAAAGACATCGCTGAAATTCTCGAGAATTTCAGCGATGTCTTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139209.2-848s1c1
Sequence:CCGGCCTATGCCTTTGAGAGCAAGACTCGAGTCTTGCTCTCAAAGGCATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139209.2-1246s1c1
Sequence:CCGGCGAACACCATTCAAAGATTACCTCGAGGTAATCTTTGAATGGTGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139209.2-633s1c1
Sequence:CCGGGCAACCAGTGTCAGACAAGTACTCGAGTACTTGTCTGACACTGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139209.2-1466s1c1
Sequence:CCGGGCCTGGAAGCTGGCCTAATTGCTCGAGCAATTAGGCCAGCTTCCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139209.2-1306s1c1
Sequence:CCGGCTGCAAGACGAGGTCAAATTCCTCGAGGAATTTGACCTCGTCTTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139209.2-613s1c1
Sequence:CCGGCAGTGGAAACTCTTCGAGATGCTCGAGCATCTCGAAGAGTTTCCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139209.2-1062s1c1
Sequence:CCGGCCTCGGCAACTGCAGGTTATCCTCGAGGATAACCTGCAGTTGCCGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139209
GRK7 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor kinase 7
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139209.x-722s1c1
Sequence:CCGGCTGGGAAGATGTATGCCTGTACTCGAGTACAGGCATACATCTTCCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139209.x-1630s1c1
Sequence:CCGGGCATGGCAGGAAGAAATTATACTCGAGTATAATTTCTTCCTGCCATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139209.x-1725s1c1
Sequence:CCGGTGGCGTGTGTTTGTTATTGTACTCGAGTACAATAACAAACACACGCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002406    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139209.x-1781s1c1
Sequence:CCGGCGGCTGACATAATCCTCGAATCTCGAGATTCGAGGATTATGTCAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139209.x-1522s1c1
Sequence:CCGGGCCAAAGACATCGCTGAAATTCTCGAGAATTTCAGCGATGTCTTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139209.2-848s1c1
Sequence:CCGGCCTATGCCTTTGAGAGCAAGACTCGAGTCTTGCTCTCAAAGGCATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139209.2-1246s1c1
Sequence:CCGGCGAACACCATTCAAAGATTACCTCGAGGTAATCTTTGAATGGTGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139209.2-633s1c1
Sequence:CCGGGCAACCAGTGTCAGACAAGTACTCGAGTACTTGTCTGACACTGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139209.2-1466s1c1
Sequence:CCGGGCCTGGAAGCTGGCCTAATTGCTCGAGCAATTAGGCCAGCTTCCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139209.2-1306s1c1
Sequence:CCGGCTGCAAGACGAGGTCAAATTCCTCGAGGAATTTGACCTCGTCTTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139209.2-613s1c1
Sequence:CCGGCAGTGGAAACTCTTCGAGATGCTCGAGCATCTCGAAGAGTTTCCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139209.2-1062s1c1
Sequence:CCGGCCTCGGCAACTGCAGGTTATCCTCGAGGATAACCTGCAGTTGCCGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139209
GRK7 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor kinase 7
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139209.x-722s1c1
Sequence:CCGGCTGGGAAGATGTATGCCTGTACTCGAGTACAGGCATACATCTTCCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139209.x-1630s1c1
Sequence:CCGGGCATGGCAGGAAGAAATTATACTCGAGTATAATTTCTTCCTGCCATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139209.x-1725s1c1
Sequence:CCGGTGGCGTGTGTTTGTTATTGTACTCGAGTACAATAACAAACACACGCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002406    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139209.x-1781s1c1
Sequence:CCGGCGGCTGACATAATCCTCGAATCTCGAGATTCGAGGATTATGTCAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139209.x-1522s1c1
Sequence:CCGGGCCAAAGACATCGCTGAAATTCTCGAGAATTTCAGCGATGTCTTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139209.2-848s1c1
Sequence:CCGGCCTATGCCTTTGAGAGCAAGACTCGAGTCTTGCTCTCAAAGGCATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139209.2-1246s1c1
Sequence:CCGGCGAACACCATTCAAAGATTACCTCGAGGTAATCTTTGAATGGTGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139209.2-633s1c1
Sequence:CCGGGCAACCAGTGTCAGACAAGTACTCGAGTACTTGTCTGACACTGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139209.2-1466s1c1
Sequence:CCGGGCCTGGAAGCTGGCCTAATTGCTCGAGCAATTAGGCCAGCTTCCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139209.2-1306s1c1
Sequence:CCGGCTGCAAGACGAGGTCAAATTCCTCGAGGAATTTGACCTCGTCTTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139209.2-613s1c1
Sequence:CCGGCAGTGGAAACTCTTCGAGATGCTCGAGCATCTCGAAGAGTTTCCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139209.2-1062s1c1
Sequence:CCGGCCTCGGCAACTGCAGGTTATCCTCGAGGATAACCTGCAGTTGCCGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)