EMAIL THIS PAGE TO A FRIEND

GRM1

glutamate receptor, metabotropic 1

Synonyms: GPRC1A MGLU1 MGLUR1 SCAR13
Gene ID:
Human(2911) Summary: This gene encodes a metabotropic glutamate receptor that functions by activating phospholipase C. L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The canonical alpha isoform of the encoded protein is a disulfide-linked homodimer whose activity is mediated by a G-protein-coupled phosphatidylinositol-calcium second messenger system. This gene may be associated with many disease states, including schizophrenia, bipolar disorder, depression, and breast cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
Mouse(14816) glutamate receptor, metabotropic 1
Rat(24414) glutamate receptor, metabotropic 1
domestic guinea pig(100730891) glutamate receptor, metabotropic 1
naked mole-rat(101712477) glutamate receptor, metabotropic 1
Domestic Rabbit(100356201) glutamate receptor, metabotropic 1
Zebrafish(100150246) glutamate receptor, metabotropic 1
dog(484024) glutamate receptor, metabotropic 1
domestic cat(101094104) glutamate receptor, metabotropic 1
cow(540485) glutamate receptor, metabotropic 1
Horse(100060603) glutamate receptor, metabotropic 1
chicken(421614) glutamate receptor, metabotropic 1
279 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
A9950 Aniracetam ≥98% human, rat pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
Q2128 Quisqualic acid powder rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000838 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000838 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000838 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016976 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016976 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016976 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000838 Rosetta Predictions human pricing
NM_001114329 Rosetta Predictions human pricing
NM_001114330 Rosetta Predictions rat pricing
NM_017011 Rosetta Predictions rat pricing
NM_001114333 Rosetta Predictions mouse pricing
NM_016976 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017434 predicted 2742
2 SASI_Hs01_00017435 predicted 837
3 SASI_Hs02_00303335 predicted 3360
4 SASI_Hs01_00017437 predicted 2238
5 SASI_Hs01_00017439 predicted 2591
6 SASI_Hs02_00303336 predicted 1924
7 SASI_Hs02_00303337 predicted 1017
8 SASI_Hs01_00017440 predicted 1711
9 SASI_Hs01_00017441 predicted 2481
10 SASI_Hs01_00017442 predicted 1319
11 SASI_Hs01_00017436 predicted 2639
12 SASI_Hs01_00017438 predicted 3098
13 SASI_Hs01_00017443 predicted 3045
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114329 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326504 predicted 2740
2 SASI_Hs02_00326505 predicted 841
3 SASI_Hs02_00326506 predicted 1129
4 SASI_Hs02_00326507 predicted 2244
5 SASI_Hs02_00326508 predicted 2590
6 SASI_Hs02_00326509 predicted 1925
7 SASI_Hs02_00326510 predicted 1012
8 SASI_Hs02_00326511 predicted 1713
9 SASI_Hs02_00326512 predicted 2482
10 SASI_Hs02_00326513 predicted 1315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114330 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252213 predicted 2709
2 SASI_Rn02_00252214 predicted 2512
3 SASI_Rn02_00252215 predicted 2124
4 SASI_Rn02_00252216 predicted 875
5 SASI_Rn02_00252217 predicted 924
6 SASI_Rn02_00252218 predicted 2528
7 SASI_Rn02_00252219 predicted 937
8 SASI_Rn02_00252220 predicted 2648
9 SASI_Rn02_00252221 predicted 1621
10 SASI_Rn02_00252222 predicted 2583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017011 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098842 predicted 2709
2 SASI_Rn01_00098843 predicted 2504
3 SASI_Rn01_00098844 predicted 2116
4 SASI_Rn01_00098845 predicted 879
5 SASI_Rn02_00261175 predicted 918
6 SASI_Rn01_00098846 predicted 2524
7 SASI_Rn01_00098847 predicted 936
8 SASI_Rn01_00098848 predicted 2648
9 SASI_Rn01_00098850 predicted 1615
10 SASI_Rn01_00098851 predicted 2576
11 SASI_Rn01_00098849 predicted 2156
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114333 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308540 predicted 1442
2 SASI_Mm02_00308541 predicted 2273
3 SASI_Mm02_00308542 predicted 1646
4 SASI_Mm02_00308543 predicted 2215
5 SASI_Mm02_00308544 predicted 2664
6 SASI_Mm02_00308545 predicted 947
7 SASI_Mm02_00308546 predicted 2260
8 SASI_Mm02_00308547 predicted 2549
9 SASI_Mm02_00308548 predicted 2803
10 SASI_Mm02_00308549 predicted 2132
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016976 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091312 predicted 1443
2 SASI_Mm01_00091313 predicted 2273
3 SASI_Mm01_00091314 predicted 1638
4 SASI_Mm01_00091315 predicted 2215
5 SASI_Mm02_00323828 predicted 2671
6 SASI_Mm01_00091317 predicted 944
7 SASI_Mm01_00091318 predicted 2262
8 SASI_Mm01_00091319 predicted 2553
9 SASI_Mm02_00323829 predicted 2805
10 SASI_Mm01_00091320 predicted 2132
11 SASI_Mm01_00091316 predicted 1886
12 SASI_Mm01_00091321 predicted 1653
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000838
GRM1 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, metabotropic 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000838.3-2235s21c1
Sequence:CCGGAGCAACATCGAATCCATTATACTCGAGTATAATGGATTCGATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000838.3-1892s21c1
Sequence:CCGGCGCTCCTGGAAGGTATGATATCTCGAGATATCATACCTTCCAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000838.3-3761s21c1
Sequence:CCGGCGACGACAGCGAGAGGTTTAACTCGAGTTAAACCTCTCGCTGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009006    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000838.2-6376s1c1
Sequence:CCGGGCCTACTATTATCCTGATTATCTCGAGATAATCAGGATAATAGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000838.2-2443s1c1
Sequence:CCGGCCCAAGTATCAAGGAAGTCTACTCGAGTAGACTTCCTTGATACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000838.2-875s1c1
Sequence:CCGGGCCATGCTTGACATAGTCAAACTCGAGTTTGACTATGTCAAGCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000838.2-2851s1c1
Sequence:CCGGCCTCAACATCTTCCGAAGAAACTCGAGTTTCTTCGGAAGATGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000838
GRM1 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, metabotropic 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000838.3-2235s21c1
Sequence:CCGGAGCAACATCGAATCCATTATACTCGAGTATAATGGATTCGATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000838.3-1892s21c1
Sequence:CCGGCGCTCCTGGAAGGTATGATATCTCGAGATATCATACCTTCCAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000838.3-3761s21c1
Sequence:CCGGCGACGACAGCGAGAGGTTTAACTCGAGTTAAACCTCTCGCTGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009006    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000838.2-6376s1c1
Sequence:CCGGGCCTACTATTATCCTGATTATCTCGAGATAATCAGGATAATAGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000838.2-2443s1c1
Sequence:CCGGCCCAAGTATCAAGGAAGTCTACTCGAGTAGACTTCCTTGATACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000838.2-875s1c1
Sequence:CCGGGCCATGCTTGACATAGTCAAACTCGAGTTTGACTATGTCAAGCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000838.2-2851s1c1
Sequence:CCGGCCTCAACATCTTCCGAAGAAACTCGAGTTTCTTCGGAAGATGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000838
GRM1 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, metabotropic 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000838.3-2235s21c1
Sequence:CCGGAGCAACATCGAATCCATTATACTCGAGTATAATGGATTCGATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000838.3-1892s21c1
Sequence:CCGGCGCTCCTGGAAGGTATGATATCTCGAGATATCATACCTTCCAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000838.3-3761s21c1
Sequence:CCGGCGACGACAGCGAGAGGTTTAACTCGAGTTAAACCTCTCGCTGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009006    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000838.2-6376s1c1
Sequence:CCGGGCCTACTATTATCCTGATTATCTCGAGATAATCAGGATAATAGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000838.2-2443s1c1
Sequence:CCGGCCCAAGTATCAAGGAAGTCTACTCGAGTAGACTTCCTTGATACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000838.2-875s1c1
Sequence:CCGGGCCATGCTTGACATAGTCAAACTCGAGTTTGACTATGTCAAGCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000838.2-2851s1c1
Sequence:CCGGCCTCAACATCTTCCGAAGAAACTCGAGTTTCTTCGGAAGATGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016976
GRM1 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, metabotropic 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016976.1-2071s1c1
Sequence:CCGGGCCTGCAAAGAGAATGAGTTTCTCGAGAAACTCATTCTCTTTGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016976.1-2635s1c1
Sequence:CCGGCCGAGCATCAAGGAAGTCTATCTCGAGATAGACTTCCTTGATGCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016976.1-667s1c1
Sequence:CCGGGCCATGTTCCACACATTAGATCTCGAGATCTAATGTGTGGAACATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016976.1-2554s1c1
Sequence:CCGGGCCTCCATTCTGATTAGTGTACTCGAGTACACTAATCAGAATGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016976.1-3194s1c1
Sequence:CCGGCCTGTAACCAAACAGCCGTAACTCGAGTTACGGCTGTTTGGTTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016976
GRM1 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, metabotropic 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016976.1-2071s1c1
Sequence:CCGGGCCTGCAAAGAGAATGAGTTTCTCGAGAAACTCATTCTCTTTGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016976.1-2635s1c1
Sequence:CCGGCCGAGCATCAAGGAAGTCTATCTCGAGATAGACTTCCTTGATGCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016976.1-667s1c1
Sequence:CCGGGCCATGTTCCACACATTAGATCTCGAGATCTAATGTGTGGAACATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016976.1-2554s1c1
Sequence:CCGGGCCTCCATTCTGATTAGTGTACTCGAGTACACTAATCAGAATGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016976.1-3194s1c1
Sequence:CCGGCCTGTAACCAAACAGCCGTAACTCGAGTTACGGCTGTTTGGTTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016976
GRM1 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, metabotropic 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016976.1-2071s1c1
Sequence:CCGGGCCTGCAAAGAGAATGAGTTTCTCGAGAAACTCATTCTCTTTGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016976.1-2635s1c1
Sequence:CCGGCCGAGCATCAAGGAAGTCTATCTCGAGATAGACTTCCTTGATGCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016976.1-667s1c1
Sequence:CCGGGCCATGTTCCACACATTAGATCTCGAGATCTAATGTGTGGAACATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016976.1-2554s1c1
Sequence:CCGGGCCTCCATTCTGATTAGTGTACTCGAGTACACTAATCAGAATGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016976.1-3194s1c1
Sequence:CCGGCCTGTAACCAAACAGCCGTAACTCGAGTTACGGCTGTTTGGTTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks