EMAIL THIS PAGE TO A FRIEND

GRM2

glutamate receptor, metabotropic 2

100 Gene Product Result for
Synonyms: GLUR2 GPRC1B MGLUR2 mGlu2
UniProtKB ID: Q14416, B0M0K7, Q14CU5, Q52MC6, Q9H3N6
Gene ID:
Human(2912) Summary: L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(108068) glutamate receptor, metabotropic 2
Rat(24415) glutamate receptor, metabotropic 2
chicken(427575) glutamate receptor, metabotropic 2
dog(484751) glutamate receptor, metabotropic 2
domestic cat(101098611) glutamate receptor, metabotropic 2
cow(519904) glutamate receptor, metabotropic 2
Horse(100052178) glutamate receptor, metabotropic 2
sheep(101116870) glutamate receptor, metabotropic 2
domestic guinea pig(100720736) glutamate receptor, metabotropic 2
naked mole-rat(101722804) glutamate receptor, metabotropic 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
A9950 Aniracetam ≥98% human, rat pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
Q2128 Quisqualic acid powder rat pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
09581 L-Glutamic acid tested according to Ph.Eur. human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000839 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000839 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000839 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_001475814 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001475814 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001475814 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU199441 MISSION® esiRNA esiRNA targeting mouse Grm2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000839 Rosetta Predictions human pricing
NM_001105711 Rosetta Predictions rat pricing
XM_001475814 Rosetta Predictions mouse pricing
XM_909627 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000839 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239483 predicted 547
2 SASI_Hs01_00239484 predicted 1628
3 SASI_Hs01_00239485 predicted 687
4 SASI_Hs01_00239486 predicted 1357
5 SASI_Hs01_00239487 predicted 688
6 SASI_Hs01_00239488 predicted 624
7 SASI_Hs01_00239489 predicted 445
8 SASI_Hs01_00239490 predicted 515
9 SASI_Hs01_00239491 predicted 500
10 SASI_Hs02_00303338 predicted 546
11 SASI_Hs01_00239482 predicted 592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105711 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211776 predicted 1415
2 SASI_Rn02_00211777 predicted 708
3 SASI_Rn02_00211778 predicted 1303
4 SASI_Rn02_00211779 predicted 2885
5 SASI_Rn02_00211780 predicted 2752
6 SASI_Rn02_00211781 predicted 1969
7 SASI_Rn02_00211782 predicted 2859
8 SASI_Rn02_00211783 predicted 606
9 SASI_Rn02_00211784 predicted 1792
10 SASI_Rn02_00211785 predicted 2727
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001475814 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00385122 predicted 2613
2 SASI_Mm02_00385123 predicted 754
3 SASI_Mm02_00385124 predicted 779
4 SASI_Mm02_00385125 predicted 2601
5 SASI_Mm02_00385126 predicted 2657
6 SASI_Mm02_00385127 predicted 2651
7 SASI_Mm02_00385128 predicted 2646
8 SASI_Mm02_00385129 predicted 2606
9 SASI_Mm02_00385130 predicted 759
10 SASI_Mm02_00385131 predicted 806
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_909627 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00434958 predicted 1973
2 SASI_Mm02_00434959 predicted 1530
3 SASI_Mm02_00434960 predicted 773
4 SASI_Mm02_00434961 predicted 1316
5 SASI_Mm02_00434962 predicted 1159
6 SASI_Mm02_00434963 predicted 620
7 SASI_Mm02_00434964 predicted 2407
8 SASI_Mm02_00434965 predicted 622
9 SASI_Mm02_00434966 predicted 1807
10 SASI_Mm02_00434967 predicted 868
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000839
GRM2 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, metabotropic 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000839.1-1007s1c1
Sequence:CCGGCCCTTGGAACAACAGCCGGAACTCGAGTTCCGGCTGTTGTTCCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000839.1-1850s1c1
Sequence:CCGGCTACTGCATGACCTTCATCTTCTCGAGAAGATGAAGGTCATGCAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000839.1-2335s1c1
Sequence:CCGGCCATCTTCTATGTCACCTCCACTCGAGTGGAGGTGACATAGAAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000839.1-401s1c1
Sequence:CCGGCACTGCCATCACTGGTGTTATCTCGAGATAACACCAGTGATGGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000839.3-1504s21c1
Sequence:CCGGTTGTGCTCAACGTCAAGTTTGCTCGAGCAAACTTGACGTTGAGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000839.3-2937s21c1
Sequence:CCGGGCTGGAGCACTGCAATAATTTCTCGAGAAATTATTGCAGTGCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000839.3-1570s21c1
Sequence:CCGGACCGCTTTGGTGATGGTATTGCTCGAGCAATACCATCACCAAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000839.3-1369s21c1
Sequence:CCGGAGATCATGTTTGTGGTCAATGCTCGAGCATTGACCACAAACATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000839
GRM2 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, metabotropic 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000839.1-1007s1c1
Sequence:CCGGCCCTTGGAACAACAGCCGGAACTCGAGTTCCGGCTGTTGTTCCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000839.1-1850s1c1
Sequence:CCGGCTACTGCATGACCTTCATCTTCTCGAGAAGATGAAGGTCATGCAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000839.1-2335s1c1
Sequence:CCGGCCATCTTCTATGTCACCTCCACTCGAGTGGAGGTGACATAGAAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000839.1-401s1c1
Sequence:CCGGCACTGCCATCACTGGTGTTATCTCGAGATAACACCAGTGATGGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000839.3-1504s21c1
Sequence:CCGGTTGTGCTCAACGTCAAGTTTGCTCGAGCAAACTTGACGTTGAGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000839.3-2937s21c1
Sequence:CCGGGCTGGAGCACTGCAATAATTTCTCGAGAAATTATTGCAGTGCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000839.3-1570s21c1
Sequence:CCGGACCGCTTTGGTGATGGTATTGCTCGAGCAATACCATCACCAAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000839.3-1369s21c1
Sequence:CCGGAGATCATGTTTGTGGTCAATGCTCGAGCATTGACCACAAACATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000839
GRM2 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, metabotropic 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000839.1-1007s1c1
Sequence:CCGGCCCTTGGAACAACAGCCGGAACTCGAGTTCCGGCTGTTGTTCCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000839.1-1850s1c1
Sequence:CCGGCTACTGCATGACCTTCATCTTCTCGAGAAGATGAAGGTCATGCAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000839.1-2335s1c1
Sequence:CCGGCCATCTTCTATGTCACCTCCACTCGAGTGGAGGTGACATAGAAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000839.1-401s1c1
Sequence:CCGGCACTGCCATCACTGGTGTTATCTCGAGATAACACCAGTGATGGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000839.3-1504s21c1
Sequence:CCGGTTGTGCTCAACGTCAAGTTTGCTCGAGCAAACTTGACGTTGAGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000839.3-2937s21c1
Sequence:CCGGGCTGGAGCACTGCAATAATTTCTCGAGAAATTATTGCAGTGCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000839.3-1570s21c1
Sequence:CCGGACCGCTTTGGTGATGGTATTGCTCGAGCAATACCATCACCAAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000839.3-1369s21c1
Sequence:CCGGAGATCATGTTTGTGGTCAATGCTCGAGCATTGACCACAAACATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001475814
GRM2 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, metabotropic 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001475814.1-1251s21c1
Sequence:GTACCGGAGGAGTCAAAGATCATGTTTGCTCGAGCAAACATGATCTTTGACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001475814.1-2470s1c1
Sequence:CCGGCTACGTCACCTCCAGTGATTACTCGAGTAATCACTGGAGGTGACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001475814.1-645s1c1
Sequence:CCGGTGAGCGACAAGTCCCGTTATGCTCGAGCATAACGGGACTTGTCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001475814.1-1461s1c1
Sequence:CCGGACCGCTTTGGAGATGGTATTGCTCGAGCAATACCATCTCCAAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219561    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_001475814.1-3128s1c1
Sequence:CCGGGGTTAGAGAGGAAGGTTATTGCTCGAGCAATAACCTTCCTCTCTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001475814.1-3128s21c1
Sequence:CCGGGGTTAGAGAGGAAGGTTATTGCTCGAGCAATAACCTTCCTCTCTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001475814.1-2470s21c1
Sequence:CCGGCTACGTCACCTCCAGTGATTACTCGAGTAATCACTGGAGGTGACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001475814.1-1461s21c1
Sequence:CCGGACCGCTTTGGAGATGGTATTGCTCGAGCAATACCATCTCCAAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001475814.1-645s21c1
Sequence:CCGGTGAGCGACAAGTCCCGTTATGCTCGAGCATAACGGGACTTGTCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001475814
GRM2 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, metabotropic 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001475814.1-1251s21c1
Sequence:GTACCGGAGGAGTCAAAGATCATGTTTGCTCGAGCAAACATGATCTTTGACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001475814.1-2470s1c1
Sequence:CCGGCTACGTCACCTCCAGTGATTACTCGAGTAATCACTGGAGGTGACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001475814.1-645s1c1
Sequence:CCGGTGAGCGACAAGTCCCGTTATGCTCGAGCATAACGGGACTTGTCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001475814.1-1461s1c1
Sequence:CCGGACCGCTTTGGAGATGGTATTGCTCGAGCAATACCATCTCCAAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219561    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_001475814.1-3128s1c1
Sequence:CCGGGGTTAGAGAGGAAGGTTATTGCTCGAGCAATAACCTTCCTCTCTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001475814.1-3128s21c1
Sequence:CCGGGGTTAGAGAGGAAGGTTATTGCTCGAGCAATAACCTTCCTCTCTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001475814.1-2470s21c1
Sequence:CCGGCTACGTCACCTCCAGTGATTACTCGAGTAATCACTGGAGGTGACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001475814.1-1461s21c1
Sequence:CCGGACCGCTTTGGAGATGGTATTGCTCGAGCAATACCATCTCCAAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001475814.1-645s21c1
Sequence:CCGGTGAGCGACAAGTCCCGTTATGCTCGAGCATAACGGGACTTGTCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001475814
GRM2 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, metabotropic 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001475814.1-1251s21c1
Sequence:GTACCGGAGGAGTCAAAGATCATGTTTGCTCGAGCAAACATGATCTTTGACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001475814.1-2470s1c1
Sequence:CCGGCTACGTCACCTCCAGTGATTACTCGAGTAATCACTGGAGGTGACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001475814.1-645s1c1
Sequence:CCGGTGAGCGACAAGTCCCGTTATGCTCGAGCATAACGGGACTTGTCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001475814.1-1461s1c1
Sequence:CCGGACCGCTTTGGAGATGGTATTGCTCGAGCAATACCATCTCCAAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219561    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_001475814.1-3128s1c1
Sequence:CCGGGGTTAGAGAGGAAGGTTATTGCTCGAGCAATAACCTTCCTCTCTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001475814.1-3128s21c1
Sequence:CCGGGGTTAGAGAGGAAGGTTATTGCTCGAGCAATAACCTTCCTCTCTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001475814.1-2470s21c1
Sequence:CCGGCTACGTCACCTCCAGTGATTACTCGAGTAATCACTGGAGGTGACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001475814.1-1461s21c1
Sequence:CCGGACCGCTTTGGAGATGGTATTGCTCGAGCAATACCATCTCCAAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001475814.1-645s21c1
Sequence:CCGGTGAGCGACAAGTCCCGTTATGCTCGAGCATAACGGGACTTGTCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks