EMAIL THIS PAGE TO A FRIEND

GRM3

glutamate receptor, metabotropic 3

Synonyms: GLUR3 GPRC1C MGLUR3 mGlu3
UniProtKB ID: Q14832, Q75MV4, Q75N17, Q86YG6, Q8TBH9
Gene ID:
Human(2913) Summary: L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. [provided by RefSeq, Jul 2008]
Mouse(108069) glutamate receptor, metabotropic 3
Rat(24416) glutamate receptor, metabotropic 3
Zebrafish(565256) glutamate receptor, metabotropic 3
dog(100683236) glutamate receptor, metabotropic 3
domestic cat(101095810) glutamate receptor, metabotropic 3
cow(541056) glutamate receptor, metabotropic 3
Horse(100049918) glutamate receptor, metabotropic 3
chicken(418644) glutamate receptor, metabotropic 3
domestic guinea pig(100731837) glutamate receptor, metabotropic 3
naked mole-rat(101713039) glutamate receptor, metabotropic 3
sheep(101113057) glutamate receptor, metabotropic 3
118 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
A9950 Aniracetam ≥98% human, rat pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
A4910 DL-2-Amino-3-phosphonopropionic acid human pricing
M4796 (±)-α-Methyl-(4-carboxyphenyl)glycine human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000840 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000840 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000840 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181850 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181850 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181850 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126661 MISSION® esiRNA esiRNA human GRM3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000840 Rosetta Predictions human pricing
NM_001105712 Rosetta Predictions rat pricing
XM_342626 Rosetta Predictions rat pricing
NM_181850 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000840 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150965 predicted 3177
2 SASI_Hs01_00150966 predicted 1458
3 SASI_Hs01_00150967 predicted 2667
4 SASI_Hs01_00150969 predicted 1531
5 SASI_Hs01_00150970 predicted 2863
6 SASI_Hs01_00150972 predicted 2486
7 SASI_Hs01_00150973 predicted 3465
8 SASI_Hs02_00303339 predicted 2698
9 SASI_Hs01_00150974 predicted 1276
10 SASI_Hs02_00303340 predicted 3238
11 SASI_Hs01_00150968 predicted 2972
12 SASI_Hs01_00150971 predicted 1635
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105712 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211786 predicted 503
2 SASI_Rn02_00211787 predicted 759
3 SASI_Rn02_00211788 predicted 232
4 SASI_Rn02_00211789 predicted 1987
5 SASI_Rn02_00211790 predicted 1607
6 SASI_Rn02_00211791 predicted 692
7 SASI_Rn02_00211792 predicted 1192
8 SASI_Rn02_00211793 predicted 1889
9 SASI_Rn02_00211794 predicted 1827
10 SASI_Rn02_00211795 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342626 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00195076 predicted 3332
2 SASI_Rn01_00195077 predicted 2880
3 SASI_Rn01_00195078 predicted 2500
4 SASI_Rn01_00195079 predicted 3678
5 SASI_Rn01_00195080 predicted 2083
6 SASI_Rn01_00195081 predicted 2783
7 SASI_Rn01_00195082 predicted 2723
8 SASI_Rn01_00195083 predicted 2569
9 SASI_Rn01_00195084 predicted 3664
10 SASI_Rn01_00195085 predicted 2930
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181850 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162085 predicted 2586
2 SASI_Mm01_00162086 predicted 1969
3 SASI_Mm01_00162087 predicted 2133
4 SASI_Mm01_00162088 predicted 896
5 SASI_Mm01_00162090 predicted 694
6 SASI_Mm01_00162091 predicted 2105
7 SASI_Mm01_00162092 predicted 2083
8 SASI_Mm01_00162093 predicted 2027
9 SASI_Mm01_00162094 predicted 1639
10 SASI_Mm02_00349938 predicted 1751
11 SASI_Mm01_00162089 predicted 834
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000840
GRM3 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, metabotropic 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000840.2-2570s21c1
Sequence:CCGGTCGCTAGATGTCAACTCTATCCTCGAGGATAGAGTTGACATCTAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000840.2-3445s21c1
Sequence:CCGGGTTGGCCTTCCTCCCTATATTCTCGAGAATATAGGGAGGAAGGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000840.2-1636s21c1
Sequence:CCGGTGATAAGTCGCGCTATGATTACTCGAGTAATCATAGCGCGACTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000840.2-1456s21c1
Sequence:CCGGAGTGGATGAAGCTGAGTATATCTCGAGATATACTCAGCTTCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000840.1-380s1c1
Sequence:CCGGGCCTGTTTCCTATTAACGAAACTCGAGTTTCGTTAATAGGAAACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000840.1-1600s1c1
Sequence:CCGGGCAGATAGCATAGTCAAGTTTCTCGAGAAACTTGACTATGCTATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000840.1-3099s1c1
Sequence:CCGGCAGAACATGGAAATAACCATTCTCGAGAATGGTTATTTCCATGTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000840.1-2550s1c1
Sequence:CCGGCGAAGCTAAGTTCATAGGTTTCTCGAGAAACCTATGAACTTAGCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000840.1-2121s1c1
Sequence:CCGGCCTGTCATACTGCATGACATTCTCGAGAATGTCATGCAGTATGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000840
GRM3 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, metabotropic 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000840.2-2570s21c1
Sequence:CCGGTCGCTAGATGTCAACTCTATCCTCGAGGATAGAGTTGACATCTAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000840.2-3445s21c1
Sequence:CCGGGTTGGCCTTCCTCCCTATATTCTCGAGAATATAGGGAGGAAGGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000840.2-1636s21c1
Sequence:CCGGTGATAAGTCGCGCTATGATTACTCGAGTAATCATAGCGCGACTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000840.2-1456s21c1
Sequence:CCGGAGTGGATGAAGCTGAGTATATCTCGAGATATACTCAGCTTCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000840.1-380s1c1
Sequence:CCGGGCCTGTTTCCTATTAACGAAACTCGAGTTTCGTTAATAGGAAACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000840.1-1600s1c1
Sequence:CCGGGCAGATAGCATAGTCAAGTTTCTCGAGAAACTTGACTATGCTATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000840.1-3099s1c1
Sequence:CCGGCAGAACATGGAAATAACCATTCTCGAGAATGGTTATTTCCATGTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000840.1-2550s1c1
Sequence:CCGGCGAAGCTAAGTTCATAGGTTTCTCGAGAAACCTATGAACTTAGCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000840.1-2121s1c1
Sequence:CCGGCCTGTCATACTGCATGACATTCTCGAGAATGTCATGCAGTATGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000840
GRM3 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, metabotropic 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000840.2-2570s21c1
Sequence:CCGGTCGCTAGATGTCAACTCTATCCTCGAGGATAGAGTTGACATCTAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000840.2-3445s21c1
Sequence:CCGGGTTGGCCTTCCTCCCTATATTCTCGAGAATATAGGGAGGAAGGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000840.2-1636s21c1
Sequence:CCGGTGATAAGTCGCGCTATGATTACTCGAGTAATCATAGCGCGACTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000840.2-1456s21c1
Sequence:CCGGAGTGGATGAAGCTGAGTATATCTCGAGATATACTCAGCTTCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000840.1-380s1c1
Sequence:CCGGGCCTGTTTCCTATTAACGAAACTCGAGTTTCGTTAATAGGAAACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000840.1-1600s1c1
Sequence:CCGGGCAGATAGCATAGTCAAGTTTCTCGAGAAACTTGACTATGCTATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000840.1-3099s1c1
Sequence:CCGGCAGAACATGGAAATAACCATTCTCGAGAATGGTTATTTCCATGTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000840.1-2550s1c1
Sequence:CCGGCGAAGCTAAGTTCATAGGTTTCTCGAGAAACCTATGAACTTAGCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000840.1-2121s1c1
Sequence:CCGGCCTGTCATACTGCATGACATTCTCGAGAATGTCATGCAGTATGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181850
GRM3 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, metabotropic 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000025767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181850.1-1777s1c1
Sequence:CCGGCCAGCATATAGGTGGAAAGTACTCGAGTACTTTCCACCTATATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181850.1-980s1c1
Sequence:CCGGCGCTACTTTAACTGGACCTATCTCGAGATAGGTCCAGTTAAAGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181850.1-2530s1c1
Sequence:CCGGGCGGGAAACAGTCATCCTAAACTCGAGTTTAGGATGACTGTTTCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181850.1-2232s1c1
Sequence:CCGGGCCTGTCCTATTGCATGACATCTCGAGATGTCATGCAATAGGACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181850
GRM3 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, metabotropic 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000025767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181850.1-1777s1c1
Sequence:CCGGCCAGCATATAGGTGGAAAGTACTCGAGTACTTTCCACCTATATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181850.1-980s1c1
Sequence:CCGGCGCTACTTTAACTGGACCTATCTCGAGATAGGTCCAGTTAAAGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181850.1-2530s1c1
Sequence:CCGGGCGGGAAACAGTCATCCTAAACTCGAGTTTAGGATGACTGTTTCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181850.1-2232s1c1
Sequence:CCGGGCCTGTCCTATTGCATGACATCTCGAGATGTCATGCAATAGGACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181850
GRM3 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, metabotropic 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000025767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181850.1-1777s1c1
Sequence:CCGGCCAGCATATAGGTGGAAAGTACTCGAGTACTTTCCACCTATATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181850.1-980s1c1
Sequence:CCGGCGCTACTTTAACTGGACCTATCTCGAGATAGGTCCAGTTAAAGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181850.1-2530s1c1
Sequence:CCGGGCGGGAAACAGTCATCCTAAACTCGAGTTTAGGATGACTGTTTCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181850.1-2232s1c1
Sequence:CCGGGCCTGTCCTATTGCATGACATCTCGAGATGTCATGCAATAGGACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks