EMAIL THIS PAGE TO A FRIEND

GRM4

glutamate receptor, metabotropic 4

98 Gene Product Result for
Synonyms: GPRC1D MGLUR4 mGlu4
Gene ID:
Human(2914) Summary: L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Mouse(268934) glutamate receptor, metabotropic 4
Rat(24417) glutamate receptor, metabotropic 4
sheep(101119427) glutamate receptor, metabotropic 4
domestic guinea pig(100727790) glutamate receptor, metabotropic 4
naked mole-rat(101704191) glutamate receptor, metabotropic 4
Zebrafish(567181) glutamate receptor, metabotropic 4
cow(790333) glutamate receptor, metabotropic 4
domestic cat(101094419) glutamate receptor, metabotropic 4
dog(481749) glutamate receptor, metabotropic 4
chicken(419906) glutamate receptor, metabotropic 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
G1670 Anti-Glutamate Receptor 4, Metabotropic antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB2900589 Anti-GRM4 / MGLUR4 antibody produced in rabbit affinity isolated antibody pig, rabbit, mouse, human, monkey
immunohistochemistry, western blot pricing
SAB2900681 Anti-GRM4 / MGLUR4 antibody produced in rabbit affinity isolated antibody mouse, rat, rabbit, horse, bovine, pig, human, monkey, dog
immunohistochemistry pricing
SAB4501322 Anti-MGLUR4, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
A9950 Aniracetam ≥98% human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000841 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000841 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000841 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013385 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013385 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013385 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000841 Rosetta Predictions human pricing
NM_022666 Rosetta Predictions rat pricing
NM_001013385 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000841 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077202 predicted 1499
2 SASI_Hs01_00077203 predicted 725
3 SASI_Hs01_00077204 predicted 1340
4 SASI_Hs01_00077205 predicted 1585
5 SASI_Hs01_00077206 predicted 2799
6 SASI_Hs01_00077207 predicted 844
7 SASI_Hs01_00077208 predicted 1235
8 SASI_Hs01_00077209 predicted 2677
9 SASI_Hs01_00077210 predicted 2194
10 SASI_Hs01_00077211 predicted 2868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022666 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038687 predicted 2181
2 SASI_Rn01_00038688 predicted 963
3 SASI_Rn01_00038689 predicted 3362
4 SASI_Rn01_00038690 predicted 2232
5 SASI_Rn02_00263433 predicted 1409
6 SASI_Rn01_00038691 predicted 2880
7 SASI_Rn01_00038692 predicted 1983
8 SASI_Rn01_00038693 predicted 1506
9 SASI_Rn01_00038694 predicted 2676
10 SASI_Rn02_00263434 predicted 1662
11 SASI_Rn01_00038695 predicted 2247
12 SASI_Rn01_00038696 predicted 2237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013385 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193640 predicted 248
2 SASI_Mm01_00193641 predicted 1554
3 SASI_Mm01_00193642 predicted 689
4 SASI_Mm01_00193643 predicted 1466
5 SASI_Mm01_00193644 predicted 2161
6 SASI_Mm01_00193645 predicted 193
7 SASI_Mm01_00193646 predicted 2661
8 SASI_Mm01_00193647 predicted 2573
9 SASI_Mm01_00193648 predicted 1272
10 SASI_Mm01_00193649 predicted 260
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000841
GRM4 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, metabotropic 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000841.1-3268s1c1
Sequence:CCGGGCCCTGTCTTTCTGTTCTCTTCTCGAGAAGAGAACAGAAAGACAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000841.1-1589s1c1
Sequence:CCGGGCGCTATGACATCTACCAATACTCGAGTATTGGTAGATGTCATAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000841.1-1554s1c1
Sequence:CCGGCCTGTGACCTTCAATGAGAATCTCGAGATTCTCATTGAAGGTCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000841.1-1659s21c1
Sequence:CCGGGACCACCTGCACCTTAGAATACTCGAGTATTCTAAGGTGCAGGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000841.1-1590s21c1
Sequence:CCGGCGCTATGACATCTACCAATACCTCGAGGTATTGGTAGATGTCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000841.1-1627s21c1
Sequence:CCGGCTGCCGAGTACAAGGTCATTGCTCGAGCAATGACCTTGTACTCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000841.1-362s21c1
Sequence:CCGGCAAGCCCTGTGGAGAACTTAACTCGAGTTAAGTTCTCCACAGGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000841
GRM4 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, metabotropic 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000841.1-3268s1c1
Sequence:CCGGGCCCTGTCTTTCTGTTCTCTTCTCGAGAAGAGAACAGAAAGACAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000841.1-1589s1c1
Sequence:CCGGGCGCTATGACATCTACCAATACTCGAGTATTGGTAGATGTCATAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000841.1-1554s1c1
Sequence:CCGGCCTGTGACCTTCAATGAGAATCTCGAGATTCTCATTGAAGGTCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000841.1-1659s21c1
Sequence:CCGGGACCACCTGCACCTTAGAATACTCGAGTATTCTAAGGTGCAGGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000841.1-1590s21c1
Sequence:CCGGCGCTATGACATCTACCAATACCTCGAGGTATTGGTAGATGTCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000841.1-1627s21c1
Sequence:CCGGCTGCCGAGTACAAGGTCATTGCTCGAGCAATGACCTTGTACTCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000841.1-362s21c1
Sequence:CCGGCAAGCCCTGTGGAGAACTTAACTCGAGTTAAGTTCTCCACAGGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000841
GRM4 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, metabotropic 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000841.1-3268s1c1
Sequence:CCGGGCCCTGTCTTTCTGTTCTCTTCTCGAGAAGAGAACAGAAAGACAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000841.1-1589s1c1
Sequence:CCGGGCGCTATGACATCTACCAATACTCGAGTATTGGTAGATGTCATAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000841.1-1554s1c1
Sequence:CCGGCCTGTGACCTTCAATGAGAATCTCGAGATTCTCATTGAAGGTCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000841.1-1659s21c1
Sequence:CCGGGACCACCTGCACCTTAGAATACTCGAGTATTCTAAGGTGCAGGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000841.1-1590s21c1
Sequence:CCGGCGCTATGACATCTACCAATACCTCGAGGTATTGGTAGATGTCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000841.1-1627s21c1
Sequence:CCGGCTGCCGAGTACAAGGTCATTGCTCGAGCAATGACCTTGTACTCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000841.1-362s21c1
Sequence:CCGGCAAGCCCTGTGGAGAACTTAACTCGAGTTAAGTTCTCCACAGGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013385
GRM4 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, metabotropic 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013385.1-1483s1c1
Sequence:CCGGGTACATCAGAAACGTCAACTTCTCGAGAAGTTGACGTTTCTGATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013385.1-252s1c1
Sequence:CCGGCCCACATGAACTCTATCCGTACTCGAGTACGGATAGAGTTCATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013385.1-694s1c1
Sequence:CCGGCTTGAGTGATAACAGCCGCTACTCGAGTAGCGGCTGTTATCACTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013385.1-2668s1c1
Sequence:CCGGCCCTTACAAAGCCATAATTATCTCGAGATAATTATGGCTTTGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013385.1-1861s1c1
Sequence:CCGGGCCCATACCCATTGTCAAGTTCTCGAGAACTTGACAATGGGTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013385
GRM4 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, metabotropic 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013385.1-1483s1c1
Sequence:CCGGGTACATCAGAAACGTCAACTTCTCGAGAAGTTGACGTTTCTGATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013385.1-252s1c1
Sequence:CCGGCCCACATGAACTCTATCCGTACTCGAGTACGGATAGAGTTCATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013385.1-694s1c1
Sequence:CCGGCTTGAGTGATAACAGCCGCTACTCGAGTAGCGGCTGTTATCACTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013385.1-2668s1c1
Sequence:CCGGCCCTTACAAAGCCATAATTATCTCGAGATAATTATGGCTTTGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013385.1-1861s1c1
Sequence:CCGGGCCCATACCCATTGTCAAGTTCTCGAGAACTTGACAATGGGTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013385
GRM4 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, metabotropic 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013385.1-1483s1c1
Sequence:CCGGGTACATCAGAAACGTCAACTTCTCGAGAAGTTGACGTTTCTGATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013385.1-252s1c1
Sequence:CCGGCCCACATGAACTCTATCCGTACTCGAGTACGGATAGAGTTCATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013385.1-694s1c1
Sequence:CCGGCTTGAGTGATAACAGCCGCTACTCGAGTAGCGGCTGTTATCACTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013385.1-2668s1c1
Sequence:CCGGCCCTTACAAAGCCATAATTATCTCGAGATAATTATGGCTTTGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013385.1-1861s1c1
Sequence:CCGGGCCCATACCCATTGTCAAGTTCTCGAGAACTTGACAATGGGTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks