EMAIL THIS PAGE TO A FRIEND

GRM6

glutamate receptor, metabotropic 6

91 Gene Product Result for
Synonyms: CSNB1B GPRC1F MGLUR6 mGlu6
UniProtKB ID: O15303
Gene ID:
Human(2916) Summary: L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. [provided by RefSeq, Feb 2012]
Mouse(108072) glutamate receptor, metabotropic 6
Rat(24419) glutamate receptor, metabotropic 6
dog(481452) glutamate receptor, metabotropic 6
cow(529656) glutamate receptor, metabotropic 6
domestic cat(101097449) glutamate receptor, metabotropic 6
domestic guinea pig(100722389) glutamate receptor, metabotropic 6
naked mole-rat(101717017) glutamate receptor, metabotropic 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
G1795 Anti-Glutamate Receptor 6, Metabotropic antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB2108475 Anti-GRM6 affinity isolated antibody human, yeast, pig, bovine, rat, guinea pig, rabbit, canine, mouse, zebrafish, horse
western blot pricing
AV32597 Anti-GRM6 antibody produced in rabbit affinity isolated antibody rabbit, rat, rabbit, canine, mouse, guinea pig, horse, human
western blot pricing
SAB2900137 Anti-GRM6 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB2100976 Anti-GRM6 antibody produced in rabbit affinity isolated antibody rabbit, mouse, canine, rat, guinea pig, horse, rabbit, human, sheep
western blot pricing
SAB2104128 Anti-GRM6 antibody produced in rabbit affinity isolated antibody horse, canine, mouse, rat, human, guinea pig, zebrafish, rabbit, rabbit
western blot pricing
HPA014511 Anti-GRM6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunohistochemistry pricing
SAB1306128 ANTI-METABOTROPIC GLUTAMATE RECEPTOR 6 (GPRC1F)(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
flow cytometry, western blot pricing
SAB4501324 Anti-MGLUR6, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
WH0002916M1 Monoclonal Anti-GRM6 antibody produced in mouse clone 1A11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
A9950 Aniracetam ≥98% human, rat pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
G8415 L-Glutamic acid from non-animal source, meets EP testing specifications, suitable for cell culture, 98.5-100.5% human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000843 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000843 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000843 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173372 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173372 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173372 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000843 Rosetta Predictions human pricing
NM_022920 Rosetta Predictions rat pricing
NM_173372 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000843 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237807 predicted 943
2 SASI_Hs02_00303344 predicted 1540
3 SASI_Hs02_00303345 predicted 1479
4 SASI_Hs01_00237809 predicted 2714
5 SASI_Hs02_00303346 predicted 1830
6 SASI_Hs01_00237810 predicted 2199
7 SASI_Hs01_00237815 predicted 1301
8 SASI_Hs01_00237813 predicted 2342
9 SASI_Hs02_00303347 predicted 1543
10 SASI_Hs01_00237811 predicted 2720
11 SASI_Hs01_00237806 predicted 904
12 SASI_Hs01_00237808 predicted 1309
13 SASI_Hs01_00237812 predicted 1858
14 SASI_Hs01_00237814 predicted 943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022920 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075490 predicted 872
2 SASI_Rn01_00075491 predicted 775
3 SASI_Rn01_00075492 predicted 1625
4 SASI_Rn01_00075493 predicted 1271
5 SASI_Rn01_00075494 predicted 1152
6 SASI_Rn01_00075495 predicted 1550
7 SASI_Rn01_00075496 predicted 918
8 SASI_Rn02_00263608 predicted 1072
9 SASI_Rn01_00075497 predicted 2450
10 SASI_Rn01_00075498 predicted 1141
11 SASI_Rn01_00075499 predicted 2065
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173372 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049573 predicted 251
2 SASI_Mm01_00049574 predicted 640
3 SASI_Mm01_00049575 predicted 814
4 SASI_Mm01_00049576 predicted 528
5 SASI_Mm01_00049577 predicted 1324
6 SASI_Mm01_00049578 predicted 1254
7 SASI_Mm01_00049579 predicted 963
8 SASI_Mm01_00049580 predicted 252
9 SASI_Mm01_00049581 predicted 1731
10 SASI_Mm01_00049582 predicted 978
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000843
GRM6 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, metabotropic 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000843.2-4221s1c1
Sequence:CCGGCCACTGTTTAAGATCAGTATACTCGAGTATACTGATCTTAAACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000843.2-1547s1c1
Sequence:CCGGCCCTGTGATGTTCAACGAGAACTCGAGTTCTCGTTGAACATCACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000843.2-2620s1c1
Sequence:CCGGACATCCAGACAACCACGCTAACTCGAGTTAGCGTGGTTGTCTGGATGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000843.2-2346s1c1
Sequence:CCGGAGCGTGATTGACTATGAGGAACTCGAGTTCCTCATAGTCAATCACGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000843.2-1250s1c1
Sequence:CCGGCGCCGAGTTCTGGGAAGAGAACTCGAGTTCTCTTCCCAGAACTCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000843.3-3140s21c1
Sequence:CCGGTGCCTGGTTTGCGGGAGATTTCTCGAGAAATCTCCCGCAAACCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000843.3-1513s21c1
Sequence:CCGGTTCGAGCTGTCCGCTTCAATGCTCGAGCATTGAAGCGGACAGCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000843.3-2197s21c1
Sequence:CCGGACCGTATCTACCGCATCTTTGCTCGAGCAAAGATGCGGTAGATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000843.3-1307s21c1
Sequence:CCGGAGACGATTCCACCCGCAAATGCTCGAGCATTTGCGGGTGGAATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000843
GRM6 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, metabotropic 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000843.2-4221s1c1
Sequence:CCGGCCACTGTTTAAGATCAGTATACTCGAGTATACTGATCTTAAACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000843.2-1547s1c1
Sequence:CCGGCCCTGTGATGTTCAACGAGAACTCGAGTTCTCGTTGAACATCACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000843.2-2620s1c1
Sequence:CCGGACATCCAGACAACCACGCTAACTCGAGTTAGCGTGGTTGTCTGGATGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000843.2-2346s1c1
Sequence:CCGGAGCGTGATTGACTATGAGGAACTCGAGTTCCTCATAGTCAATCACGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000843.2-1250s1c1
Sequence:CCGGCGCCGAGTTCTGGGAAGAGAACTCGAGTTCTCTTCCCAGAACTCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000843.3-3140s21c1
Sequence:CCGGTGCCTGGTTTGCGGGAGATTTCTCGAGAAATCTCCCGCAAACCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000843.3-1513s21c1
Sequence:CCGGTTCGAGCTGTCCGCTTCAATGCTCGAGCATTGAAGCGGACAGCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000843.3-2197s21c1
Sequence:CCGGACCGTATCTACCGCATCTTTGCTCGAGCAAAGATGCGGTAGATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000843.3-1307s21c1
Sequence:CCGGAGACGATTCCACCCGCAAATGCTCGAGCATTTGCGGGTGGAATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000843
GRM6 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, metabotropic 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000843.2-4221s1c1
Sequence:CCGGCCACTGTTTAAGATCAGTATACTCGAGTATACTGATCTTAAACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000843.2-1547s1c1
Sequence:CCGGCCCTGTGATGTTCAACGAGAACTCGAGTTCTCGTTGAACATCACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000843.2-2620s1c1
Sequence:CCGGACATCCAGACAACCACGCTAACTCGAGTTAGCGTGGTTGTCTGGATGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000843.2-2346s1c1
Sequence:CCGGAGCGTGATTGACTATGAGGAACTCGAGTTCCTCATAGTCAATCACGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000843.2-1250s1c1
Sequence:CCGGCGCCGAGTTCTGGGAAGAGAACTCGAGTTCTCTTCCCAGAACTCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000843.3-3140s21c1
Sequence:CCGGTGCCTGGTTTGCGGGAGATTTCTCGAGAAATCTCCCGCAAACCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000843.3-1513s21c1
Sequence:CCGGTTCGAGCTGTCCGCTTCAATGCTCGAGCATTGAAGCGGACAGCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000843.3-2197s21c1
Sequence:CCGGACCGTATCTACCGCATCTTTGCTCGAGCAAAGATGCGGTAGATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000843.3-1307s21c1
Sequence:CCGGAGACGATTCCACCCGCAAATGCTCGAGCATTTGCGGGTGGAATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173372
GRM6 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, metabotropic 6
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173372.1-526s1c1
Sequence:CCGGCCAGTGATGTTCAATGAGAATCTCGAGATTCTCATTGAACATCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173372.1-1585s1c1
Sequence:CCGGGCTGAGAAGATCTACATCCAACTCGAGTTGGATGTAGATCTTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173372.1-643s1c1
Sequence:CCGGGCCCTTAGACTGGATATGGAACTCGAGTTCCATATCCAGTCTAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026267    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173372.1-2194s1c1
Sequence:CCGGCCCAACAAGAAATCCAGGATTCTCGAGAATCCTGGATTTCTTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173372.1-953s1c1
Sequence:CCGGCCACCACAACTATCATTGCTACTCGAGTAGCAATGATAGTTGTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173372.2-3075s21c1
Sequence:CCGGGGCATTCAAACCCGTGGTAAACTCGAGTTTACCACGGGTTTGAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173372.2-2310s21c1
Sequence:CCGGCACACAGCGTGATTGACTATGCTCGAGCATAGTCAATCACGCTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173372
GRM6 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, metabotropic 6
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173372.1-526s1c1
Sequence:CCGGCCAGTGATGTTCAATGAGAATCTCGAGATTCTCATTGAACATCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173372.1-1585s1c1
Sequence:CCGGGCTGAGAAGATCTACATCCAACTCGAGTTGGATGTAGATCTTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173372.1-643s1c1
Sequence:CCGGGCCCTTAGACTGGATATGGAACTCGAGTTCCATATCCAGTCTAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026267    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173372.1-2194s1c1
Sequence:CCGGCCCAACAAGAAATCCAGGATTCTCGAGAATCCTGGATTTCTTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173372.1-953s1c1
Sequence:CCGGCCACCACAACTATCATTGCTACTCGAGTAGCAATGATAGTTGTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173372.2-3075s21c1
Sequence:CCGGGGCATTCAAACCCGTGGTAAACTCGAGTTTACCACGGGTTTGAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173372.2-2310s21c1
Sequence:CCGGCACACAGCGTGATTGACTATGCTCGAGCATAGTCAATCACGCTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173372
GRM6 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, metabotropic 6
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173372.1-526s1c1
Sequence:CCGGCCAGTGATGTTCAATGAGAATCTCGAGATTCTCATTGAACATCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173372.1-1585s1c1
Sequence:CCGGGCTGAGAAGATCTACATCCAACTCGAGTTGGATGTAGATCTTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173372.1-643s1c1
Sequence:CCGGGCCCTTAGACTGGATATGGAACTCGAGTTCCATATCCAGTCTAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026267    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173372.1-2194s1c1
Sequence:CCGGCCCAACAAGAAATCCAGGATTCTCGAGAATCCTGGATTTCTTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173372.1-953s1c1
Sequence:CCGGCCACCACAACTATCATTGCTACTCGAGTAGCAATGATAGTTGTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173372.2-3075s21c1
Sequence:CCGGGGCATTCAAACCCGTGGTAAACTCGAGTTTACCACGGGTTTGAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173372.2-2310s21c1
Sequence:CCGGCACACAGCGTGATTGACTATGCTCGAGCATAGTCAATCACGCTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks