EMAIL THIS PAGE TO A FRIEND

GRM7

glutamate receptor, metabotropic 7

186 Gene Product Result for
Synonyms: GLUR7 GPRC1G MGLU7 MGLUR7
UniProtKB ID: Q14831, Q8NFS2, Q8NFS3, Q8NFS4
Gene ID:
Human(2917) Summary: L-glutamate is the major excitatory neurotransmitter in the central nervous system, and it activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors that have been divided into three groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5, and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3, while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
Mouse(108073) glutamate receptor, metabotropic 7
Rat(81672) glutamate receptor, metabotropic 7
Zebrafish(564461) glutamate receptor, metabotropic 7
chicken(416112) glutamate receptor, metabotropic 7
cow(535362) glutamate receptor, metabotropic 7
Horse(100052696) glutamate receptor, metabotropic 7
domestic cat(101090088) glutamate receptor, metabotropic 7
dog(484674) glutamate receptor, metabotropic 7
Domestic Rabbit(100343810) glutamate receptor, metabotropic 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
A9950 Aniracetam ≥98% human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000844 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000844 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000844 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177328 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177328 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177328 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000844 Rosetta Predictions human pricing
NM_181874 Rosetta Predictions human pricing
NM_181875 Rosetta Predictions human pricing
NM_031040 Rosetta Predictions rat pricing
XM_579501 Rosetta Predictions rat pricing
NM_177328 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000844 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018554 predicted 458
2 SASI_Hs02_00303348 predicted 1491
3 SASI_Hs01_00018555 predicted 2334
4 SASI_Hs01_00018556 predicted 699
5 SASI_Hs01_00018557 predicted 2217
6 SASI_Hs01_00018558 predicted 1220
7 SASI_Hs01_00018559 predicted 1874
8 SASI_Hs01_00018560 predicted 1389
9 SASI_Hs01_00018561 predicted 2171
10 SASI_Hs01_00018563 predicted 1751
11 SASI_Hs01_00018562 predicted 1799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181874 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075802 predicted 461
2 SASI_Hs02_00370469 predicted 1493
3 SASI_Hs01_00075803 predicted 2335
4 SASI_Hs01_00075804 predicted 703
5 SASI_Hs01_00075805 predicted 2214
6 SASI_Hs01_00075806 predicted 1222
7 SASI_Hs01_00075807 predicted 1871
8 SASI_Hs01_00075808 predicted 1383
9 SASI_Hs01_00075809 predicted 2169
10 SASI_Hs01_00075811 predicted 1755
11 SASI_Hs01_00075810 predicted 1795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181875 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213988 predicted 470
2 SASI_Hs01_00213989 predicted 2340
3 SASI_Hs01_00213990 predicted 705
4 SASI_Hs01_00213991 predicted 2223
5 SASI_Hs01_00213992 predicted 1220
6 SASI_Hs01_00213993 predicted 1883
7 SASI_Hs01_00213994 predicted 1389
8 SASI_Hs01_00213995 predicted 2174
9 SASI_Hs01_00213996 predicted 1797
10 SASI_Hs01_00213997 predicted 1761
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031040 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049054 predicted 2426
2 SASI_Rn01_00049055 predicted 755
3 SASI_Rn01_00049056 predicted 1591
4 SASI_Rn02_00264262 predicted 2533
5 SASI_Rn01_00049057 predicted 2122
6 SASI_Rn01_00049058 predicted 1524
7 SASI_Rn01_00049059 predicted 1891
8 SASI_Rn01_00049060 predicted 2670
9 SASI_Rn02_00264263 predicted 1388
10 SASI_Rn01_00049063 predicted 1172
11 SASI_Rn01_00049061 predicted 2225
12 SASI_Rn01_00049062 predicted 1746
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579501 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00159246 predicted 1526
2 SASI_Rn01_00159247 predicted 1278
3 SASI_Rn01_00159248 predicted 1337
4 SASI_Rn01_00159249 predicted 1442
5 SASI_Rn01_00159250 predicted 1249
6 SASI_Rn01_00159251 predicted 1335
7 SASI_Rn01_00159252 predicted 1553
8 SASI_Rn01_00159253 predicted 1485
9 SASI_Rn01_00159254 predicted 1533
10 SASI_Rn01_00159255 predicted 1422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177328 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036951 predicted 2371
2 SASI_Mm01_00036952 predicted 620
3 SASI_Mm01_00036953 predicted 1914
4 SASI_Mm01_00036954 predicted 1758
5 SASI_Mm01_00036955 predicted 2633
6 SASI_Mm01_00036956 predicted 1997
7 SASI_Mm01_00036958 predicted 2542
8 SASI_Mm01_00036959 predicted 784
9 SASI_Mm01_00036960 predicted 1059
10 SASI_Mm02_00347433 predicted 1599
11 SASI_Mm01_00036957 predicted 1613
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000844
GRM7 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, metabotropic 7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000844.3-2307s21c1
Sequence:CCGGATCGGATTTATCGCATATTTGCTCGAGCAAATATGCGATAAATCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000844.3-1131s21c1
Sequence:CCGGTTGCCAACGATGAGGATATAACTCGAGTTATATCCTCATCGTTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000844.3-3197s21c1
Sequence:CCGGTACTTTATCTGGGCTTAATAACTCGAGTTATTAAGCCCAGATAAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000844.2-3069s1c1
Sequence:CCGGCCTTACTTTATCTGGGCTTAACTCGAGTTAAGCCCAGATAAAGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000844.2-494s1c1
Sequence:CCGGGCTCGAACAGTCGCTTACTTTCTCGAGAAAGTAAGCGACTGTTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000844.2-2230s1c1
Sequence:CCGGCCAGACTCATAAGCCCAACATCTCGAGATGTTGGGCTTATGAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000844.2-1977s1c1
Sequence:CCGGGCCACTTTCATCCGCTACAATCTCGAGATTGTAGCGGATGAAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000844.2-673s1c1
Sequence:CCGGCCCAGATTAGTTATGCATCAACTCGAGTTGATGCATAACTAATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000844
GRM7 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, metabotropic 7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000844.3-2307s21c1
Sequence:CCGGATCGGATTTATCGCATATTTGCTCGAGCAAATATGCGATAAATCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000844.3-1131s21c1
Sequence:CCGGTTGCCAACGATGAGGATATAACTCGAGTTATATCCTCATCGTTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000844.3-3197s21c1
Sequence:CCGGTACTTTATCTGGGCTTAATAACTCGAGTTATTAAGCCCAGATAAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000844.2-3069s1c1
Sequence:CCGGCCTTACTTTATCTGGGCTTAACTCGAGTTAAGCCCAGATAAAGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000844.2-494s1c1
Sequence:CCGGGCTCGAACAGTCGCTTACTTTCTCGAGAAAGTAAGCGACTGTTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000844.2-2230s1c1
Sequence:CCGGCCAGACTCATAAGCCCAACATCTCGAGATGTTGGGCTTATGAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000844.2-1977s1c1
Sequence:CCGGGCCACTTTCATCCGCTACAATCTCGAGATTGTAGCGGATGAAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000844.2-673s1c1
Sequence:CCGGCCCAGATTAGTTATGCATCAACTCGAGTTGATGCATAACTAATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000844
GRM7 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, metabotropic 7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000844.3-2307s21c1
Sequence:CCGGATCGGATTTATCGCATATTTGCTCGAGCAAATATGCGATAAATCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000844.3-1131s21c1
Sequence:CCGGTTGCCAACGATGAGGATATAACTCGAGTTATATCCTCATCGTTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000844.3-3197s21c1
Sequence:CCGGTACTTTATCTGGGCTTAATAACTCGAGTTATTAAGCCCAGATAAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000844.2-3069s1c1
Sequence:CCGGCCTTACTTTATCTGGGCTTAACTCGAGTTAAGCCCAGATAAAGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000844.2-494s1c1
Sequence:CCGGGCTCGAACAGTCGCTTACTTTCTCGAGAAAGTAAGCGACTGTTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000844.2-2230s1c1
Sequence:CCGGCCAGACTCATAAGCCCAACATCTCGAGATGTTGGGCTTATGAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000844.2-1977s1c1
Sequence:CCGGGCCACTTTCATCCGCTACAATCTCGAGATTGTAGCGGATGAAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000844.2-673s1c1
Sequence:CCGGCCCAGATTAGTTATGCATCAACTCGAGTTGATGCATAACTAATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177328
GRM7 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, metabotropic 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177328.3-1127s21c1
Sequence:CCGGTTGCCAACGATGAGGATATAACTCGAGTTATATCCTCATCGTTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177328.3-2301s1c1
Sequence:CCGGCAATCGGATTTATCGCATATTCTCGAGAATATGCGATAAATCCGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216447    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177328.3-3767s1c1
Sequence:CCGGGAATAGAGGTCTTGATCTTTGCTCGAGCAAAGATCAAGACCTCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177328.3-3871s21c1
Sequence:CCGGACTTAGGGTATATGGATATTTCTCGAGAAATATCCATATACCCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177328.3-2260s21c1
Sequence:CCGGTTGGGTATGTGTATTAGTTATCTCGAGATAACTAATACACATACCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177328.3-1914s21c1
Sequence:CCGGTGATGGATACCAGTATCAATTCTCGAGAATTGATACTGGTATCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177328.3-2674s21c1
Sequence:CCGGCTTGCCTTCATCCCAATATTTCTCGAGAAATATTGGGATGAAGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177328.2-931s1c1
Sequence:CCGGGTATCTACTCTTGCATCTGAACTCGAGTTCAGATGCAAGAGTAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177328.2-2187s1c1
Sequence:CCGGCTATATCATCACCTTCCTAATCTCGAGATTAGGAAGGTGATGATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177328.2-2413s1c1
Sequence:CCGGCTAGGTGTCTTTATTTGGTTTCTCGAGAAACCAAATAAAGACACCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177328
GRM7 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, metabotropic 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177328.3-1127s21c1
Sequence:CCGGTTGCCAACGATGAGGATATAACTCGAGTTATATCCTCATCGTTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177328.3-2301s1c1
Sequence:CCGGCAATCGGATTTATCGCATATTCTCGAGAATATGCGATAAATCCGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216447    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177328.3-3767s1c1
Sequence:CCGGGAATAGAGGTCTTGATCTTTGCTCGAGCAAAGATCAAGACCTCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177328.3-3871s21c1
Sequence:CCGGACTTAGGGTATATGGATATTTCTCGAGAAATATCCATATACCCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177328.3-2260s21c1
Sequence:CCGGTTGGGTATGTGTATTAGTTATCTCGAGATAACTAATACACATACCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177328.3-1914s21c1
Sequence:CCGGTGATGGATACCAGTATCAATTCTCGAGAATTGATACTGGTATCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177328.3-2674s21c1
Sequence:CCGGCTTGCCTTCATCCCAATATTTCTCGAGAAATATTGGGATGAAGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177328.2-931s1c1
Sequence:CCGGGTATCTACTCTTGCATCTGAACTCGAGTTCAGATGCAAGAGTAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177328.2-2187s1c1
Sequence:CCGGCTATATCATCACCTTCCTAATCTCGAGATTAGGAAGGTGATGATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177328.2-2413s1c1
Sequence:CCGGCTAGGTGTCTTTATTTGGTTTCTCGAGAAACCAAATAAAGACACCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177328
GRM7 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, metabotropic 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177328.3-1127s21c1
Sequence:CCGGTTGCCAACGATGAGGATATAACTCGAGTTATATCCTCATCGTTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177328.3-2301s1c1
Sequence:CCGGCAATCGGATTTATCGCATATTCTCGAGAATATGCGATAAATCCGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216447    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177328.3-3767s1c1
Sequence:CCGGGAATAGAGGTCTTGATCTTTGCTCGAGCAAAGATCAAGACCTCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177328.3-3871s21c1
Sequence:CCGGACTTAGGGTATATGGATATTTCTCGAGAAATATCCATATACCCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177328.3-2260s21c1
Sequence:CCGGTTGGGTATGTGTATTAGTTATCTCGAGATAACTAATACACATACCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177328.3-1914s21c1
Sequence:CCGGTGATGGATACCAGTATCAATTCTCGAGAATTGATACTGGTATCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177328.3-2674s21c1
Sequence:CCGGCTTGCCTTCATCCCAATATTTCTCGAGAAATATTGGGATGAAGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177328.2-931s1c1
Sequence:CCGGGTATCTACTCTTGCATCTGAACTCGAGTTCAGATGCAAGAGTAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177328.2-2187s1c1
Sequence:CCGGCTATATCATCACCTTCCTAATCTCGAGATTAGGAAGGTGATGATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177328.2-2413s1c1
Sequence:CCGGCTAGGTGTCTTTATTTGGTTTCTCGAGAAACCAAATAAAGACACCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks