EMAIL THIS PAGE TO A FRIEND

GRM8

glutamate receptor, metabotropic 8

125 Gene Product Result for
Synonyms: GLUR8 GPRC1H MGLUR8 mGlu8
Gene ID:
Human(2918) Summary: L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(14823) glutamate receptor, metabotropic 8
Rat(60590) glutamate receptor, metabotropic 8
chicken(427853) glutamate receptor, metabotropic 8
cow(538360) glutamate receptor, metabotropic 8
Horse(100071655) glutamate receptor, metabotropic 8
dog(482270) glutamate receptor, metabotropic 8
sheep(101108742) glutamate receptor, metabotropic 8
Domestic Rabbit(100328635) glutamate receptor, metabotropic 8
domestic guinea pig(100725321) glutamate receptor, metabotropic 8
naked mole-rat(101697666) glutamate receptor, metabotropic 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
A9950 Aniracetam ≥98% human, rat pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
A4910 DL-2-Amino-3-phosphonopropionic acid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000845 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000845 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000845 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008174 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008174 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008174 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000845 Rosetta Predictions human pricing
NM_001127323 Rosetta Predictions human pricing
NM_001127326 Rosetta Predictions human pricing
NM_022202 Rosetta Predictions rat pricing
NM_008174 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303349 predicted 572
2 SASI_Hs02_00303350 predicted 781
3 SASI_Hs01_00048730 predicted 2674
4 SASI_Hs01_00048732 predicted 2200
5 SASI_Hs01_00048734 predicted 736
6 SASI_Hs01_00048736 predicted 549
7 SASI_Hs02_00303351 predicted 1367
8 SASI_Hs01_00048737 predicted 951
9 SASI_Hs01_00048739 predicted 2218
10 SASI_Hs02_00303352 predicted 658
11 SASI_Hs01_00048731 predicted 1370
12 SASI_Hs01_00048733 predicted 1529
13 SASI_Hs01_00048735 predicted 1217
14 SASI_Hs01_00048738 predicted 1458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127323 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329117 predicted 823
2 SASI_Hs02_00329118 predicted 1025
3 SASI_Hs02_00329119 predicted 2923
4 SASI_Hs02_00329120 predicted 2444
5 SASI_Hs02_00329121 predicted 986
6 SASI_Hs02_00329122 predicted 799
7 SASI_Hs02_00329123 predicted 1617
8 SASI_Hs02_00329124 predicted 1196
9 SASI_Hs02_00329125 predicted 2468
10 SASI_Hs02_00329126 predicted 904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127326 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329137 predicted 570
2 SASI_Hs02_00329138 predicted 1125
3 SASI_Hs02_00329139 predicted 785
4 SASI_Hs02_00329140 predicted 743
5 SASI_Hs02_00329141 predicted 1116
6 SASI_Hs02_00329142 predicted 743
7 SASI_Hs02_00329143 predicted 551
8 SASI_Hs02_00329144 predicted 1367
9 SASI_Hs02_00329145 predicted 782
10 SASI_Hs02_00329146 predicted 1023
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022202 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262952 predicted 2398
2 SASI_Rn01_00072017 predicted 2435
3 SASI_Rn02_00262953 predicted 968
4 SASI_Rn02_00262954 predicted 1954
5 SASI_Rn01_00072019 predicted 309
6 SASI_Rn01_00072020 predicted 497
7 SASI_Rn01_00072021 predicted 1395
8 SASI_Rn01_00072022 predicted 1222
9 SASI_Rn01_00072024 predicted 559
10 SASI_Rn01_00072025 predicted 1561
11 SASI_Rn01_00072018 predicted 293
12 SASI_Rn01_00072023 predicted 617
13 SASI_Rn01_00072026 predicted 1888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008174 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168358 predicted 2736
2 SASI_Mm01_00168360 predicted 2713
3 SASI_Mm01_00168361 predicted 585
4 SASI_Mm01_00168362 predicted 795
5 SASI_Mm02_00313297 predicted 3131
6 SASI_Mm02_00313298 predicted 612
7 SASI_Mm01_00168364 predicted 1693
8 SASI_Mm01_00168366 predicted 924
9 SASI_Mm02_00313299 predicted 3087
10 SASI_Mm01_00168367 predicted 1528
11 SASI_Mm01_00168359 predicted 975
12 SASI_Mm01_00168363 predicted 1136
13 SASI_Mm01_00168365 predicted 1384
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000845
GRM8 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, metabotropic 8
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000845.1-1875s1c1
Sequence:CCGGCCGCTATAATGACACACCTATCTCGAGATAGGTGTGTCATTATAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000845.1-603s1c1
Sequence:CCGGGCTAAGTGATAACACCAGGTACTCGAGTACCTGGTGTTATCACTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000845.1-2426s1c1
Sequence:CCGGCCTGCATCATTTGGTTAGCTTCTCGAGAAGCTAACCAAATGATGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000845.1-489s1c1
Sequence:CCGGCGACAAGATTTCTGGCGTCATCTCGAGATGACGCCAGAAATCTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000845.2-2118s21c1
Sequence:CCGGGTGACCTTTGTCCGCTATAATCTCGAGATTATAGCGGACAAAGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000845.2-787s21c1
Sequence:CCGGCCATCATGGTTGCTAACATTTCTCGAGAAATGTTAGCAACCATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000845.2-2320s21c1
Sequence:CCGGCAAACCGTATCCACCGAATATCTCGAGATATTCGGTGGATACGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000845.2-1164s21c1
Sequence:CCGGGATGACATCAGGAGGATATTGCTCGAGCAATATCCTCCTGATGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000845
GRM8 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, metabotropic 8
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000845.1-1875s1c1
Sequence:CCGGCCGCTATAATGACACACCTATCTCGAGATAGGTGTGTCATTATAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000845.1-603s1c1
Sequence:CCGGGCTAAGTGATAACACCAGGTACTCGAGTACCTGGTGTTATCACTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000845.1-2426s1c1
Sequence:CCGGCCTGCATCATTTGGTTAGCTTCTCGAGAAGCTAACCAAATGATGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000845.1-489s1c1
Sequence:CCGGCGACAAGATTTCTGGCGTCATCTCGAGATGACGCCAGAAATCTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000845.2-2118s21c1
Sequence:CCGGGTGACCTTTGTCCGCTATAATCTCGAGATTATAGCGGACAAAGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000845.2-787s21c1
Sequence:CCGGCCATCATGGTTGCTAACATTTCTCGAGAAATGTTAGCAACCATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000845.2-2320s21c1
Sequence:CCGGCAAACCGTATCCACCGAATATCTCGAGATATTCGGTGGATACGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000845.2-1164s21c1
Sequence:CCGGGATGACATCAGGAGGATATTGCTCGAGCAATATCCTCCTGATGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000845
GRM8 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, metabotropic 8
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000845.1-1875s1c1
Sequence:CCGGCCGCTATAATGACACACCTATCTCGAGATAGGTGTGTCATTATAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000845.1-603s1c1
Sequence:CCGGGCTAAGTGATAACACCAGGTACTCGAGTACCTGGTGTTATCACTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000845.1-2426s1c1
Sequence:CCGGCCTGCATCATTTGGTTAGCTTCTCGAGAAGCTAACCAAATGATGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000845.1-489s1c1
Sequence:CCGGCGACAAGATTTCTGGCGTCATCTCGAGATGACGCCAGAAATCTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000845.2-2118s21c1
Sequence:CCGGGTGACCTTTGTCCGCTATAATCTCGAGATTATAGCGGACAAAGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000845.2-787s21c1
Sequence:CCGGCCATCATGGTTGCTAACATTTCTCGAGAAATGTTAGCAACCATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000845.2-2320s21c1
Sequence:CCGGCAAACCGTATCCACCGAATATCTCGAGATATTCGGTGGATACGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000845.2-1164s21c1
Sequence:CCGGGATGACATCAGGAGGATATTGCTCGAGCAATATCCTCCTGATGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008174
GRM8 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, metabotropic 8
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008174.1-1888s1c1
Sequence:CCGGCCGCTATAATGACACACCAATCTCGAGATTGGTGTGTCATTATAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008174.1-2439s1c1
Sequence:CCGGCGTGCATCATTTGGTTAGCTTCTCGAGAAGCTAACCAAATGATGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008174.1-1478s1c1
Sequence:CCGGCGCTACGATATCTTCCAATATCTCGAGATATTGGAAGATATCGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008174.1-898s1c1
Sequence:CCGGCGCAGTGATTATGTTTGCCAACTCGAGTTGGCAAACATAATCACTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008174.1-502s1c1
Sequence:CCGGCGACAAGATTTCTGGTGTCATCTCGAGATGACACCAGAAATCTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008174.2-2657s1c1
Sequence:CCGGCTTGTACTGTTTATGCCATTACTCGAGTAATGGCATAAACAGTACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219408    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008174.2-1872s1c1
Sequence:CCGGAGACATGCAGTGGGCTAATAGCTCGAGCTATTAGCCCACTGCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008174.2-1704s1c1
Sequence:CCGGTTACATCAGGGCCGTGAATTTCTCGAGAAATTCACGGCCCTGATGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008174.2-1420s1c1
Sequence:CCGGCTTGCCAATAATCGAAGAAATCTCGAGATTTCTTCGATTATTGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008174.2-1225s1c1
Sequence:CCGGGATGACATCAGGAGGATATTGCTCGAGCAATATCCTCCTGATGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008174.2-2381s1c1
Sequence:CCGGCAAACCGTATCCACCGAATATCTCGAGATATTCGGTGGATACGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008174.2-924s1c1
Sequence:CCGGTGACAACACCAGGTATGATTTCTCGAGAAATCATACCTGGTGTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008174.2-848s1c1
Sequence:CCGGCCATCATGGTGGCTAACATTTCTCGAGAAATGTTAGCCACCATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008174.2-613s1c1
Sequence:CCGGTATGCAATCGACCAGATTAATCTCGAGATTAATCTGGTCGATTGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008174.2-1986s1c1
Sequence:CCGGTGAACGCTGCGAGGGTTATAACTCGAGTTATAACCCTCGCAGCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008174
GRM8 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, metabotropic 8
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008174.1-1888s1c1
Sequence:CCGGCCGCTATAATGACACACCAATCTCGAGATTGGTGTGTCATTATAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008174.1-2439s1c1
Sequence:CCGGCGTGCATCATTTGGTTAGCTTCTCGAGAAGCTAACCAAATGATGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008174.1-1478s1c1
Sequence:CCGGCGCTACGATATCTTCCAATATCTCGAGATATTGGAAGATATCGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008174.1-898s1c1
Sequence:CCGGCGCAGTGATTATGTTTGCCAACTCGAGTTGGCAAACATAATCACTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008174.1-502s1c1
Sequence:CCGGCGACAAGATTTCTGGTGTCATCTCGAGATGACACCAGAAATCTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008174.2-2657s1c1
Sequence:CCGGCTTGTACTGTTTATGCCATTACTCGAGTAATGGCATAAACAGTACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219408    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008174.2-1872s1c1
Sequence:CCGGAGACATGCAGTGGGCTAATAGCTCGAGCTATTAGCCCACTGCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008174.2-1704s1c1
Sequence:CCGGTTACATCAGGGCCGTGAATTTCTCGAGAAATTCACGGCCCTGATGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008174.2-1420s1c1
Sequence:CCGGCTTGCCAATAATCGAAGAAATCTCGAGATTTCTTCGATTATTGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008174.2-1225s1c1
Sequence:CCGGGATGACATCAGGAGGATATTGCTCGAGCAATATCCTCCTGATGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008174.2-2381s1c1
Sequence:CCGGCAAACCGTATCCACCGAATATCTCGAGATATTCGGTGGATACGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008174.2-924s1c1
Sequence:CCGGTGACAACACCAGGTATGATTTCTCGAGAAATCATACCTGGTGTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008174.2-848s1c1
Sequence:CCGGCCATCATGGTGGCTAACATTTCTCGAGAAATGTTAGCCACCATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008174.2-613s1c1
Sequence:CCGGTATGCAATCGACCAGATTAATCTCGAGATTAATCTGGTCGATTGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008174.2-1986s1c1
Sequence:CCGGTGAACGCTGCGAGGGTTATAACTCGAGTTATAACCCTCGCAGCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008174
GRM8 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, metabotropic 8
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008174.1-1888s1c1
Sequence:CCGGCCGCTATAATGACACACCAATCTCGAGATTGGTGTGTCATTATAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008174.1-2439s1c1
Sequence:CCGGCGTGCATCATTTGGTTAGCTTCTCGAGAAGCTAACCAAATGATGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008174.1-1478s1c1
Sequence:CCGGCGCTACGATATCTTCCAATATCTCGAGATATTGGAAGATATCGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008174.1-898s1c1
Sequence:CCGGCGCAGTGATTATGTTTGCCAACTCGAGTTGGCAAACATAATCACTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008174.1-502s1c1
Sequence:CCGGCGACAAGATTTCTGGTGTCATCTCGAGATGACACCAGAAATCTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008174.2-2657s1c1
Sequence:CCGGCTTGTACTGTTTATGCCATTACTCGAGTAATGGCATAAACAGTACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219408    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008174.2-1872s1c1
Sequence:CCGGAGACATGCAGTGGGCTAATAGCTCGAGCTATTAGCCCACTGCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008174.2-1704s1c1
Sequence:CCGGTTACATCAGGGCCGTGAATTTCTCGAGAAATTCACGGCCCTGATGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008174.2-1420s1c1
Sequence:CCGGCTTGCCAATAATCGAAGAAATCTCGAGATTTCTTCGATTATTGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008174.2-1225s1c1
Sequence:CCGGGATGACATCAGGAGGATATTGCTCGAGCAATATCCTCCTGATGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008174.2-2381s1c1
Sequence:CCGGCAAACCGTATCCACCGAATATCTCGAGATATTCGGTGGATACGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008174.2-924s1c1
Sequence:CCGGTGACAACACCAGGTATGATTTCTCGAGAAATCATACCTGGTGTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008174.2-848s1c1
Sequence:CCGGCCATCATGGTGGCTAACATTTCTCGAGAAATGTTAGCCACCATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008174.2-613s1c1
Sequence:CCGGTATGCAATCGACCAGATTAATCTCGAGATTAATCTGGTCGATTGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008174.2-1986s1c1
Sequence:CCGGTGAACGCTGCGAGGGTTATAACTCGAGTTATAACCCTCGCAGCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks