EMAIL THIS PAGE TO A FRIEND

GRP

gastrin-releasing peptide

74 Gene Product Result for
Synonyms: BN GRP-10 preproGRP proGRP
UniProtKB ID: P07492, P07491, P81553, Q14454, Q53YA0, Q9BSY7
Gene ID:
Human(2922) Summary: This gene encodes a member of the bombesin-like family of gastrin-releasing peptides. Its preproprotein, following cleavage of a signal peptide, is further processed to produce either the 27 aa gastrin-releasing peptide or the 10 aa neuromedin C. These smaller peptides regulate numerous functions of the gastrointestinal and central nervous systems, including release of gastrointestinal hormones, smooth muscle cell contraction, and epithelial cell proliferation. These peptides are also likely to play a role in human cancers of the lung, colon, stomach, pancreas, breast, and prostate. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(225642) gastrin releasing peptide
Rat(171101) gastrin releasing peptide
Zebrafish(559978) gastrin-releasing peptide
cow(615323) gastrin-releasing peptide
Horse(100050124) gastrin-releasing peptide
dog(610154) gastrin-releasing peptide
chicken(425213) gastrin-releasing peptide
fruit fly(39824) Gag related protein
sheep(443332) gastrin-releasing peptide
domestic guinea pig(100728828) gastrin-releasing peptide
naked mole-rat(101722365) gastrin-releasing peptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175012 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175012 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175012 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002091 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002091 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002091 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152471 MISSION® esiRNA esiRNA human GRP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012512 Rosetta Predictions human pricing
NM_001012513 Rosetta Predictions human pricing
NM_002091 Rosetta Predictions human pricing
NM_133570 Rosetta Predictions rat pricing
NM_175012 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012512 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121136 predicted 429
2 SASI_Hs01_00121138 predicted 509
3 SASI_Hs01_00121139 predicted 498
4 SASI_Hs01_00121140 predicted 437
5 SASI_Hs01_00121141 predicted 504
6 SASI_Hs01_00121142 predicted 333
7 SASI_Hs02_00306183 predicted 577
8 SASI_Hs01_00121143 predicted 353
9 SASI_Hs02_00306184 predicted 473
10 SASI_Hs01_00121145 predicted 569
11 SASI_Hs01_00121137 predicted 480
12 SASI_Hs01_00121144 predicted 457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012513 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130711 predicted 432
2 SASI_Hs01_00130712 predicted 502
3 SASI_Hs01_00130713 predicted 501
4 SASI_Hs01_00130714 predicted 506
5 SASI_Hs01_00130715 predicted 333
6 SASI_Hs01_00130716 predicted 585
7 SASI_Hs01_00130717 predicted 349
8 SASI_Hs01_00130718 predicted 569
9 SASI_Hs01_00130719 predicted 585
10 SASI_Hs01_00130720 predicted 566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002091 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070153 predicted 434
2 SASI_Hs01_00070154 predicted 528
3 SASI_Hs01_00070155 predicted 526
4 SASI_Hs01_00070156 predicted 441
5 SASI_Hs01_00070157 predicted 525
6 SASI_Hs01_00070158 predicted 337
7 SASI_Hs02_00333182 predicted 604
8 SASI_Hs01_00070159 predicted 350
9 SASI_Hs01_00070161 predicted 586
10 SASI_Hs02_00333183 predicted 607
11 SASI_Hs01_00070160 predicted 447
12 SASI_Hs01_00070162 predicted 589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133570 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107237 predicted 593
2 SASI_Rn01_00107239 predicted 522
3 SASI_Rn01_00107240 predicted 351
4 SASI_Rn01_00107241 predicted 630
5 SASI_Rn01_00107242 predicted 629
6 SASI_Rn02_00267762 predicted 460
7 SASI_Rn01_00107243 predicted 615
8 SASI_Rn01_00107244 predicted 444
9 SASI_Rn01_00107245 predicted 593
10 SASI_Rn02_00267763 predicted 331
11 SASI_Rn01_00107238 predicted 304
12 SASI_Rn01_00107246 predicted 199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175012 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193822 predicted 492
2 SASI_Mm01_00193823 predicted 364
3 SASI_Mm01_00193824 predicted 546
4 SASI_Mm01_00193825 predicted 633
5 SASI_Mm01_00193826 predicted 382
6 SASI_Mm01_00193827 predicted 470
7 SASI_Mm01_00193828 predicted 464
8 SASI_Mm02_00345577 predicted 362
9 SASI_Mm01_00193829 predicted 617
10 SASI_Mm02_00345578 predicted 531
11 SASI_Mm01_00193820 predicted 442
12 SASI_Mm01_00193821 predicted 606
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175012
GRP MISSION shRNA Bacterial Glycerol Stock
gastrin-releasing peptide
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175012.2-692s1c1
Sequence:CCGGCCGCAACTAAACTCGTGATTTCTCGAGAAATCACGAGTTTAGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175012.2-254s1c1
Sequence:CCGGTGTGGGACACTTAATGGGAAACTCGAGTTTCCCATTAAGTGTCCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175012.2-494s1c1
Sequence:CCGGCGCTAAGTTGGTAGACTCTCTCTCGAGAGAGAGTCTACCAACTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175012.2-372s1c1
Sequence:CCGGGATTTGCTGGACCTCCTAGAACTCGAGTTCTAGGAGGTCCAGCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175012.2-472s1c1
Sequence:CCGGGCTACTTTAACGACGTTCAAACTCGAGTTTGAACGTCGTTAAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175012
GRP MISSION shRNA shRNA Plasmid DNA
gastrin-releasing peptide
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175012.2-692s1c1
Sequence:CCGGCCGCAACTAAACTCGTGATTTCTCGAGAAATCACGAGTTTAGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175012.2-254s1c1
Sequence:CCGGTGTGGGACACTTAATGGGAAACTCGAGTTTCCCATTAAGTGTCCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175012.2-494s1c1
Sequence:CCGGCGCTAAGTTGGTAGACTCTCTCTCGAGAGAGAGTCTACCAACTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175012.2-372s1c1
Sequence:CCGGGATTTGCTGGACCTCCTAGAACTCGAGTTCTAGGAGGTCCAGCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175012.2-472s1c1
Sequence:CCGGGCTACTTTAACGACGTTCAAACTCGAGTTTGAACGTCGTTAAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175012
GRP MISSION shRNA Lentiviral Transduction Particles
gastrin-releasing peptide
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175012.2-692s1c1
Sequence:CCGGCCGCAACTAAACTCGTGATTTCTCGAGAAATCACGAGTTTAGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175012.2-254s1c1
Sequence:CCGGTGTGGGACACTTAATGGGAAACTCGAGTTTCCCATTAAGTGTCCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175012.2-494s1c1
Sequence:CCGGCGCTAAGTTGGTAGACTCTCTCTCGAGAGAGAGTCTACCAACTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175012.2-372s1c1
Sequence:CCGGGATTTGCTGGACCTCCTAGAACTCGAGTTCTAGGAGGTCCAGCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175012.2-472s1c1
Sequence:CCGGGCTACTTTAACGACGTTCAAACTCGAGTTTGAACGTCGTTAAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002091
GRP MISSION shRNA Bacterial Glycerol Stock
gastrin-releasing peptide
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002091.3-344s1c1
Sequence:CCGGGAATTTGCTGGGTCTCATAGACTCGAGTCTATGAGACCCAGCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002091.3-445s1c1
Sequence:CCGGGCAGCAACTTCAAAGATGTAGCTCGAGCTACATCTTTGAAGTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002091.3-441s1c1
Sequence:CCGGGATAGCAGCAACTTCAAAGATCTCGAGATCTTTGAAGTTGCTGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002091.3-624s1c1
Sequence:CCGGCAACAAGATTTCCTTGTGCAACTCGAGTTGCACAAGGAAATCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152467    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002091.3-694s1c1
Sequence:CCGGCAAGCAGCATCTTCTGGTTTACTCGAGTAAACCAGAAGATGCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002091.3-274s1c1
Sequence:CCGGCTTCTGTTTCTGAGAGAGGGACTCGAGTCCCTCTCTCAGAAACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002091.3-600s1c1
Sequence:CCGGGCAAGCATCAGTTCTACGGATCTCGAGATCCGTAGAACTGATGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002091.3-315s1c1
Sequence:CCGGGAGTACATCAGGTGGGAAGAACTCGAGTTCTTCCCACCTGATGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002091.3-350s1c1
Sequence:CCGGGCTGGGTCTCATAGAAGCAAACTCGAGTTTGCTTCTATGAGACCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002091.3-475s1c1
Sequence:CCGGGCAAAGTTGGTAGACTCTCTGCTCGAGCAGAGAGTCTACCAACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002091.3-424s1c1
Sequence:CCGGCTTCGTGGGATTCAGAGGATACTCGAGTATCCTCTGAATCCCACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002091
GRP MISSION shRNA shRNA Plasmid DNA
gastrin-releasing peptide
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002091.3-344s1c1
Sequence:CCGGGAATTTGCTGGGTCTCATAGACTCGAGTCTATGAGACCCAGCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002091.3-445s1c1
Sequence:CCGGGCAGCAACTTCAAAGATGTAGCTCGAGCTACATCTTTGAAGTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002091.3-441s1c1
Sequence:CCGGGATAGCAGCAACTTCAAAGATCTCGAGATCTTTGAAGTTGCTGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002091.3-624s1c1
Sequence:CCGGCAACAAGATTTCCTTGTGCAACTCGAGTTGCACAAGGAAATCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152467    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002091.3-694s1c1
Sequence:CCGGCAAGCAGCATCTTCTGGTTTACTCGAGTAAACCAGAAGATGCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002091.3-274s1c1
Sequence:CCGGCTTCTGTTTCTGAGAGAGGGACTCGAGTCCCTCTCTCAGAAACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002091.3-600s1c1
Sequence:CCGGGCAAGCATCAGTTCTACGGATCTCGAGATCCGTAGAACTGATGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002091.3-315s1c1
Sequence:CCGGGAGTACATCAGGTGGGAAGAACTCGAGTTCTTCCCACCTGATGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002091.3-350s1c1
Sequence:CCGGGCTGGGTCTCATAGAAGCAAACTCGAGTTTGCTTCTATGAGACCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002091.3-475s1c1
Sequence:CCGGGCAAAGTTGGTAGACTCTCTGCTCGAGCAGAGAGTCTACCAACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002091.3-424s1c1
Sequence:CCGGCTTCGTGGGATTCAGAGGATACTCGAGTATCCTCTGAATCCCACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002091
GRP MISSION shRNA Lentiviral Transduction Particles
gastrin-releasing peptide
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002091.3-344s1c1
Sequence:CCGGGAATTTGCTGGGTCTCATAGACTCGAGTCTATGAGACCCAGCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002091.3-445s1c1
Sequence:CCGGGCAGCAACTTCAAAGATGTAGCTCGAGCTACATCTTTGAAGTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002091.3-441s1c1
Sequence:CCGGGATAGCAGCAACTTCAAAGATCTCGAGATCTTTGAAGTTGCTGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002091.3-624s1c1
Sequence:CCGGCAACAAGATTTCCTTGTGCAACTCGAGTTGCACAAGGAAATCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152467    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002091.3-694s1c1
Sequence:CCGGCAAGCAGCATCTTCTGGTTTACTCGAGTAAACCAGAAGATGCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002091.3-274s1c1
Sequence:CCGGCTTCTGTTTCTGAGAGAGGGACTCGAGTCCCTCTCTCAGAAACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002091.3-600s1c1
Sequence:CCGGGCAAGCATCAGTTCTACGGATCTCGAGATCCGTAGAACTGATGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002091.3-315s1c1
Sequence:CCGGGAGTACATCAGGTGGGAAGAACTCGAGTTCTTCCCACCTGATGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002091.3-350s1c1
Sequence:CCGGGCTGGGTCTCATAGAAGCAAACTCGAGTTTGCTTCTATGAGACCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002091.3-475s1c1
Sequence:CCGGGCAAAGTTGGTAGACTCTCTGCTCGAGCAGAGAGTCTACCAACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002091.3-424s1c1
Sequence:CCGGCTTCGTGGGATTCAGAGGATACTCGAGTATCCTCTGAATCCCACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks