EMAIL THIS PAGE TO A FRIEND

GRPEL1

GrpE-like 1, mitochondrial (E. coli)

98 Gene Product Result for
Synonyms: HMGE
UniProtKB ID: Q9HAV7, B2R783, Q549M6
Gene ID:
Mouse(17713) GrpE-like 1, mitochondrial
Rat(79563) GrpE-like 1, mitochondrial
domestic guinea pig(100734584) GrpE-like 1, mitochondrial (E. coli)
naked mole-rat(101716240) GrpE-like 1, mitochondrial (E. coli)
Zebrafish(559037) GrpE-like 1, mitochondrial
chicken(422865) GrpE-like 1, mitochondrial (E. coli)
dog(488784) GrpE-like 1, mitochondrial (E. coli)
domestic cat(101090011) GrpE-like 1, mitochondrial (E. coli)
cow(515580) GrpE-like 1, mitochondrial (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025196 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025196 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025196 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024478 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024478 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024478 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025196 Rosetta Predictions human pricing
NM_024487 Rosetta Predictions rat pricing
NM_024478 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025196 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054166 predicted 890
2 SASI_Hs02_00357972 predicted 340
3 SASI_Hs01_00054167 predicted 541
4 SASI_Hs01_00054168 predicted 729
5 SASI_Hs01_00054169 predicted 504
6 SASI_Hs01_00054170 predicted 352
7 SASI_Hs02_00357973 predicted 640
8 SASI_Hs01_00054172 predicted 427
9 SASI_Hs02_00357974 predicted 364
10 SASI_Hs01_00054174 predicted 566
11 SASI_Hs01_00054165 predicted 539
12 SASI_Hs01_00054171 predicted 400
13 SASI_Hs01_00054173 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024487 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264018 predicted 517
2 SASI_Rn02_00264019 predicted 677
3 SASI_Rn02_00264020 predicted 572
4 SASI_Rn01_00109773 predicted 441
5 SASI_Rn02_00264021 predicted 672
6 SASI_Rn01_00109774 predicted 250
7 SASI_Rn01_00109775 predicted 293
8 SASI_Rn02_00264022 predicted 697
9 SASI_Rn02_00264023 predicted 419
10 SASI_Rn02_00264024 predicted 723
11 SASI_Rn01_00109770 predicted 841
12 SASI_Rn01_00109771 predicted 456
13 SASI_Rn01_00109772 predicted 915
14 SASI_Rn01_00109776 predicted 907
15 SASI_Rn01_00109777 predicted 301
16 SASI_Rn01_00109778 predicted 523
17 SASI_Rn01_00109779 predicted 925
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059488 predicted 450
2 SASI_Mm01_00059489 predicted 1053
3 SASI_Mm01_00059490 predicted 835
4 SASI_Mm01_00059492 predicted 919
5 SASI_Mm01_00059493 predicted 890
6 SASI_Mm01_00059494 predicted 1057
7 SASI_Mm01_00059495 predicted 503
8 SASI_Mm01_00059496 predicted 1133
9 SASI_Mm02_00327860 predicted 506
10 SASI_Mm01_00059497 predicted 885
11 SASI_Mm01_00059491 predicted 438
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025196
VALIDATED
GRPEL1 MISSION shRNA Bacterial Glycerol Stock
GrpE-like 1, mitochondrial (E. coli)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_025196.2-548s1c1
Sequence:CCGGGTTCGACCCTTATGAACATGACTCGAGTCATGTTCATAAGGGTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_025196.2-896s1c1
Sequence:CCGGCGCGTTGAATAGTTCCACATACTCGAGTATGTGGAACTATTCAACGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025196.2-491s1c1
Sequence:CCGGGATCCAGAAGGTGTTCACAAACTCGAGTTTGTGAACACCTTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_025196.2-170s1c1
Sequence:CCGGCATGGGTCAGAGTGAACAGAACTCGAGTTCTGTTCACTCTGACCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025196.2-177s1c1
Sequence:CCGGCAGAGTGAACAGAAGGCAGATCTCGAGATCTGCCTTCTGTTCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_025196.2-506s1c1
Sequence:CCGGCACAAAGCATGGCTTGCTCAACTCGAGTTGAGCAAGCCATGCTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025196.2-228s1c1
Sequence:CCGGGAGAAGGTCAAGTTGGAGGAACTCGAGTTCCTCCAACTTGACCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025196.2-512s1c1
Sequence:CCGGGCATGGCTTGCTCAAGTTGAACTCGAGTTCAACTTGAGCAAGCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157194    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_025196.2-1094s1c1
Sequence:CCGGGCGTATTTAGCCCGTCACATTCTCGAGAATGTGACGGGCTAAATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025196.2-896s21c1
Sequence:CCGGCGCGTTGAATAGTTCCACATACTCGAGTATGTGGAACTATTCAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025196.2-548s21c1
Sequence:CCGGGTTCGACCCTTATGAACATGACTCGAGTCATGTTCATAAGGGTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025196.2-512s21c1
Sequence:CCGGGCATGGCTTGCTCAAGTTGAACTCGAGTTCAACTTGAGCAAGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025196.2-170s21c1
Sequence:CCGGCATGGGTCAGAGTGAACAGAACTCGAGTTCTGTTCACTCTGACCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025196.2-491s21c1
Sequence:CCGGGATCCAGAAGGTGTTCACAAACTCGAGTTTGTGAACACCTTCTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025196
VALIDATED
GRPEL1 MISSION shRNA shRNA Plasmid DNA
GrpE-like 1, mitochondrial (E. coli)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_025196.2-548s1c1
Sequence:CCGGGTTCGACCCTTATGAACATGACTCGAGTCATGTTCATAAGGGTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_025196.2-896s1c1
Sequence:CCGGCGCGTTGAATAGTTCCACATACTCGAGTATGTGGAACTATTCAACGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025196.2-491s1c1
Sequence:CCGGGATCCAGAAGGTGTTCACAAACTCGAGTTTGTGAACACCTTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_025196.2-170s1c1
Sequence:CCGGCATGGGTCAGAGTGAACAGAACTCGAGTTCTGTTCACTCTGACCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025196.2-177s1c1
Sequence:CCGGCAGAGTGAACAGAAGGCAGATCTCGAGATCTGCCTTCTGTTCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_025196.2-506s1c1
Sequence:CCGGCACAAAGCATGGCTTGCTCAACTCGAGTTGAGCAAGCCATGCTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025196.2-228s1c1
Sequence:CCGGGAGAAGGTCAAGTTGGAGGAACTCGAGTTCCTCCAACTTGACCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025196.2-512s1c1
Sequence:CCGGGCATGGCTTGCTCAAGTTGAACTCGAGTTCAACTTGAGCAAGCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157194    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_025196.2-1094s1c1
Sequence:CCGGGCGTATTTAGCCCGTCACATTCTCGAGAATGTGACGGGCTAAATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025196.2-896s21c1
Sequence:CCGGCGCGTTGAATAGTTCCACATACTCGAGTATGTGGAACTATTCAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025196.2-548s21c1
Sequence:CCGGGTTCGACCCTTATGAACATGACTCGAGTCATGTTCATAAGGGTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025196.2-512s21c1
Sequence:CCGGGCATGGCTTGCTCAAGTTGAACTCGAGTTCAACTTGAGCAAGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025196.2-170s21c1
Sequence:CCGGCATGGGTCAGAGTGAACAGAACTCGAGTTCTGTTCACTCTGACCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025196.2-491s21c1
Sequence:CCGGGATCCAGAAGGTGTTCACAAACTCGAGTTTGTGAACACCTTCTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025196
VALIDATED
GRPEL1 MISSION shRNA Lentiviral Transduction Particles
GrpE-like 1, mitochondrial (E. coli)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_025196.2-548s1c1
Sequence:CCGGGTTCGACCCTTATGAACATGACTCGAGTCATGTTCATAAGGGTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_025196.2-896s1c1
Sequence:CCGGCGCGTTGAATAGTTCCACATACTCGAGTATGTGGAACTATTCAACGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025196.2-491s1c1
Sequence:CCGGGATCCAGAAGGTGTTCACAAACTCGAGTTTGTGAACACCTTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_025196.2-170s1c1
Sequence:CCGGCATGGGTCAGAGTGAACAGAACTCGAGTTCTGTTCACTCTGACCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025196.2-177s1c1
Sequence:CCGGCAGAGTGAACAGAAGGCAGATCTCGAGATCTGCCTTCTGTTCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_025196.2-506s1c1
Sequence:CCGGCACAAAGCATGGCTTGCTCAACTCGAGTTGAGCAAGCCATGCTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025196.2-228s1c1
Sequence:CCGGGAGAAGGTCAAGTTGGAGGAACTCGAGTTCCTCCAACTTGACCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025196.2-512s1c1
Sequence:CCGGGCATGGCTTGCTCAAGTTGAACTCGAGTTCAACTTGAGCAAGCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157194    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_025196.2-1094s1c1
Sequence:CCGGGCGTATTTAGCCCGTCACATTCTCGAGAATGTGACGGGCTAAATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025196.2-896s21c1
Sequence:CCGGCGCGTTGAATAGTTCCACATACTCGAGTATGTGGAACTATTCAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025196.2-548s21c1
Sequence:CCGGGTTCGACCCTTATGAACATGACTCGAGTCATGTTCATAAGGGTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025196.2-512s21c1
Sequence:CCGGGCATGGCTTGCTCAAGTTGAACTCGAGTTCAACTTGAGCAAGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025196.2-170s21c1
Sequence:CCGGCATGGGTCAGAGTGAACAGAACTCGAGTTCTGTTCACTCTGACCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025196.2-491s21c1
Sequence:CCGGGATCCAGAAGGTGTTCACAAACTCGAGTTTGTGAACACCTTCTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024478
VALIDATED
GRPEL1 MISSION shRNA Bacterial Glycerol Stock
GrpE-like 1, mitochondrial (E. coli)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024478.2-882s1c1
Sequence:CCGGCGGGAGTAGTATGCTAACATTCTCGAGAATGTTAGCATACTACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024478.2-263s1c1
Sequence:CCGGCTGAGAATCTACGGCAGAGAACTCGAGTTCTCTGCCGTAGATTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024478.2-442s1c1
Sequence:CCGGGTGATGACTGAAGTCCAGATTCTCGAGAATCTGGACTTCAGTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024478.2-511s1c1
Sequence:CCGGGCCAAGTTCGACCCTTACGAACTCGAGTTCGTAAGGGTCGAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024478.2-97s1c1
Sequence:CCGGGCTACGAAACAGAAGAACAATCTCGAGATTGTTCTTCTGTTTCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024478.2-97s21c1
Sequence:CCGGGCTACGAAACAGAAGAACAATCTCGAGATTGTTCTTCTGTTTCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024478.2-263s21c1
Sequence:CCGGCTGAGAATCTACGGCAGAGAACTCGAGTTCTCTGCCGTAGATTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024478.2-511s21c1
Sequence:CCGGGCCAAGTTCGACCCTTACGAACTCGAGTTCGTAAGGGTCGAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024478.2-442s21c1
Sequence:CCGGGTGATGACTGAAGTCCAGATTCTCGAGAATCTGGACTTCAGTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024478
VALIDATED
GRPEL1 MISSION shRNA shRNA Plasmid DNA
GrpE-like 1, mitochondrial (E. coli)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024478.2-882s1c1
Sequence:CCGGCGGGAGTAGTATGCTAACATTCTCGAGAATGTTAGCATACTACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024478.2-263s1c1
Sequence:CCGGCTGAGAATCTACGGCAGAGAACTCGAGTTCTCTGCCGTAGATTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024478.2-442s1c1
Sequence:CCGGGTGATGACTGAAGTCCAGATTCTCGAGAATCTGGACTTCAGTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024478.2-511s1c1
Sequence:CCGGGCCAAGTTCGACCCTTACGAACTCGAGTTCGTAAGGGTCGAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024478.2-97s1c1
Sequence:CCGGGCTACGAAACAGAAGAACAATCTCGAGATTGTTCTTCTGTTTCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024478.2-97s21c1
Sequence:CCGGGCTACGAAACAGAAGAACAATCTCGAGATTGTTCTTCTGTTTCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024478.2-263s21c1
Sequence:CCGGCTGAGAATCTACGGCAGAGAACTCGAGTTCTCTGCCGTAGATTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024478.2-511s21c1
Sequence:CCGGGCCAAGTTCGACCCTTACGAACTCGAGTTCGTAAGGGTCGAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024478.2-442s21c1
Sequence:CCGGGTGATGACTGAAGTCCAGATTCTCGAGAATCTGGACTTCAGTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024478
VALIDATED
GRPEL1 MISSION shRNA Lentiviral Transduction Particles
GrpE-like 1, mitochondrial (E. coli)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024478.2-882s1c1
Sequence:CCGGCGGGAGTAGTATGCTAACATTCTCGAGAATGTTAGCATACTACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024478.2-263s1c1
Sequence:CCGGCTGAGAATCTACGGCAGAGAACTCGAGTTCTCTGCCGTAGATTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024478.2-442s1c1
Sequence:CCGGGTGATGACTGAAGTCCAGATTCTCGAGAATCTGGACTTCAGTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024478.2-511s1c1
Sequence:CCGGGCCAAGTTCGACCCTTACGAACTCGAGTTCGTAAGGGTCGAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024478.2-97s1c1
Sequence:CCGGGCTACGAAACAGAAGAACAATCTCGAGATTGTTCTTCTGTTTCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024478.2-97s21c1
Sequence:CCGGGCTACGAAACAGAAGAACAATCTCGAGATTGTTCTTCTGTTTCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024478.2-263s21c1
Sequence:CCGGCTGAGAATCTACGGCAGAGAACTCGAGTTCTCTGCCGTAGATTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024478.2-511s21c1
Sequence:CCGGGCCAAGTTCGACCCTTACGAACTCGAGTTCGTAAGGGTCGAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024478.2-442s21c1
Sequence:CCGGGTGATGACTGAAGTCCAGATTCTCGAGAATCTGGACTTCAGTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks