EMAIL THIS PAGE TO A FRIEND

GRPEL2

GrpE-like 2, mitochondrial (E. coli)

92 Gene Product Result for
Synonyms: Mt-GrpE#2
UniProtKB ID: Q8TAA5, Q49AJ6
Gene ID:
Mouse(17714) GrpE-like 2, mitochondrial
Rat(688777) GrpE-like 2, mitochondrial
chicken(768554) GrpE-like 2, mitochondrial (E. coli)
domestic cat(101086452) GrpE-like 2, mitochondrial (E. coli)
cow(514599) GrpE-like 2, mitochondrial (E. coli)
dog(489195) GrpE-like 2, mitochondrial (E. coli)
sheep(101119471) GrpE-like 2, mitochondrial (E. coli)
domestic guinea pig(100723210) GrpE-like 2, mitochondrial (E. coli)
naked mole-rat(101713615) GrpE-like 2, mitochondrial (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021296 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021296 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021296 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152407 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152407 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152407 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152407 Rosetta Predictions human pricing
NM_001109513 Rosetta Predictions rat pricing
NM_021296 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243235 predicted 1013
2 SASI_Hs01_00243237 predicted 963
3 SASI_Hs01_00243238 predicted 427
4 SASI_Hs01_00243239 predicted 910
5 SASI_Hs01_00243242 predicted 933
6 SASI_Hs01_00243243 predicted 714
7 SASI_Hs02_00366095 predicted 975
8 SASI_Hs01_00243244 predicted 821
9 SASI_Hs02_00366096 predicted 887
10 SASI_Hs02_00366097 predicted 481
11 SASI_Hs01_00243236 predicted 957
12 SASI_Hs01_00243240 predicted 443
13 SASI_Hs01_00243241 predicted 982
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109513 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249139 predicted 840
2 SASI_Rn02_00249140 predicted 829
3 SASI_Rn02_00249141 predicted 540
4 SASI_Rn02_00249142 predicted 491
5 SASI_Rn02_00249143 predicted 936
6 SASI_Rn02_00249144 predicted 1091
7 SASI_Rn02_00249145 predicted 871
8 SASI_Rn02_00249146 predicted 597
9 SASI_Rn02_00249147 predicted 1160
10 SASI_Rn02_00249148 predicted 1176
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021296 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086151 predicted 1144
2 SASI_Mm01_00086152 predicted 955
3 SASI_Mm01_00086153 predicted 738
4 SASI_Mm02_00325834 predicted 496
5 SASI_Mm01_00086155 predicted 697
6 SASI_Mm01_00086156 predicted 204
7 SASI_Mm01_00086157 predicted 1155
8 SASI_Mm01_00086158 predicted 834
9 SASI_Mm01_00086159 predicted 1104
10 SASI_Mm01_00086160 predicted 826
11 SASI_Mm01_00086154 predicted 619
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021296
VALIDATED
GRPEL2 MISSION shRNA Bacterial Glycerol Stock
GrpE-like 2, mitochondrial (E. coli)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021296.2-268s21c1
Sequence:CCGGACCAGAGAGCTGTCGCTGATTCTCGAGAATCAGCGACAGCTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021296.2-912s21c1
Sequence:CCGGGACACGTGTCGTGGCCTTTATCTCGAGATAAAGGCCACGACACGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021296.2-641s21c1
Sequence:CCGGACTTCATGGCCGCACCATTAGCTCGAGCTAATGGTGCGGCCATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021296.2-321s21c1
Sequence:CCGGGTGGAAGACGCGAAGATATTTCTCGAGAAATATCTTCGCGTCTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021296.2-213s21c1
Sequence:CCGGTTAAGGCTCAAAGCTGTTAAACTCGAGTTTAACAGCTTTGAGCCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021296.1-464s1c1
Sequence:CCGGCTGCTAGAAGCCAGACTGAAACTCGAGTTTCAGTCTGGCTTCTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021296.1-1129s1c1
Sequence:CCGGGCGTGTAGAGAGATTTCCTAACTCGAGTTAGGAAATCTCTCTACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180624    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021296.1-1320s1c1
Sequence:CCGGGCCGTGACAATACAACTCAATCTCGAGATTGAGTTGTATTGTCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021296.1-2030s1c1
Sequence:CCGGGCTGACATTGACATCACACTTCTCGAGAAGTGTGATGTCAATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021296
VALIDATED
GRPEL2 MISSION shRNA shRNA Plasmid DNA
GrpE-like 2, mitochondrial (E. coli)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021296.2-268s21c1
Sequence:CCGGACCAGAGAGCTGTCGCTGATTCTCGAGAATCAGCGACAGCTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021296.2-912s21c1
Sequence:CCGGGACACGTGTCGTGGCCTTTATCTCGAGATAAAGGCCACGACACGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021296.2-641s21c1
Sequence:CCGGACTTCATGGCCGCACCATTAGCTCGAGCTAATGGTGCGGCCATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021296.2-321s21c1
Sequence:CCGGGTGGAAGACGCGAAGATATTTCTCGAGAAATATCTTCGCGTCTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021296.2-213s21c1
Sequence:CCGGTTAAGGCTCAAAGCTGTTAAACTCGAGTTTAACAGCTTTGAGCCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021296.1-464s1c1
Sequence:CCGGCTGCTAGAAGCCAGACTGAAACTCGAGTTTCAGTCTGGCTTCTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021296.1-1129s1c1
Sequence:CCGGGCGTGTAGAGAGATTTCCTAACTCGAGTTAGGAAATCTCTCTACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180624    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021296.1-1320s1c1
Sequence:CCGGGCCGTGACAATACAACTCAATCTCGAGATTGAGTTGTATTGTCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021296.1-2030s1c1
Sequence:CCGGGCTGACATTGACATCACACTTCTCGAGAAGTGTGATGTCAATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021296
VALIDATED
GRPEL2 MISSION shRNA Lentiviral Transduction Particles
GrpE-like 2, mitochondrial (E. coli)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021296.2-268s21c1
Sequence:CCGGACCAGAGAGCTGTCGCTGATTCTCGAGAATCAGCGACAGCTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021296.2-912s21c1
Sequence:CCGGGACACGTGTCGTGGCCTTTATCTCGAGATAAAGGCCACGACACGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021296.2-641s21c1
Sequence:CCGGACTTCATGGCCGCACCATTAGCTCGAGCTAATGGTGCGGCCATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021296.2-321s21c1
Sequence:CCGGGTGGAAGACGCGAAGATATTTCTCGAGAAATATCTTCGCGTCTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021296.2-213s21c1
Sequence:CCGGTTAAGGCTCAAAGCTGTTAAACTCGAGTTTAACAGCTTTGAGCCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021296.1-464s1c1
Sequence:CCGGCTGCTAGAAGCCAGACTGAAACTCGAGTTTCAGTCTGGCTTCTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021296.1-1129s1c1
Sequence:CCGGGCGTGTAGAGAGATTTCCTAACTCGAGTTAGGAAATCTCTCTACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180624    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021296.1-1320s1c1
Sequence:CCGGGCCGTGACAATACAACTCAATCTCGAGATTGAGTTGTATTGTCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021296.1-2030s1c1
Sequence:CCGGGCTGACATTGACATCACACTTCTCGAGAAGTGTGATGTCAATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152407
VALIDATED
GRPEL2 MISSION shRNA Bacterial Glycerol Stock
GrpE-like 2, mitochondrial (E. coli)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152407.3-625s21c1
Sequence:CCGGACACCCATTGGTGACAAATATCTCGAGATATTTGTCACCAATGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152407.3-300s21c1
Sequence:CCGGTGAACGAGCCTTAAGGGTAAACTCGAGTTTACCCTTAAGGCTCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152407.3-702s21c1
Sequence:CCGGTGGCACCGTGGCATTAGTAAGCTCGAGCTTACTAATGCCACGGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152407.3-1585s21c1
Sequence:CCGGATGGCTCTATTTGGGTAATTTCTCGAGAAATTACCCAAATAGAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152407.3-738s21c1
Sequence:CCGGACTTCATGGCCGCACCATTAGCTCGAGCTAATGGTGCGGCCATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152407.2-1011s1c1
Sequence:CCGGGCGGTCTCTATAACAGGAATTCTCGAGAATTCCTGTTATAGAGACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152407.2-595s1c1
Sequence:CCGGGTGGCATTAGTAAGACAAGATCTCGAGATCTTGTCTTACTAATGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152407.2-179s1c1
Sequence:CCGGCTCTTGCTGAACGAGCCTTAACTCGAGTTAAGGCTCGTTCAGCAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152407.2-318s1c1
Sequence:CCGGGATATTTGGAATCCAGAGTTTCTCGAGAAACTCTGGATTCCAAATATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152407.2-230s1c1
Sequence:CCGGTCCAAGATTTAACAGTGAGATCTCGAGATCTCACTGTTAAATCTTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152407
VALIDATED
GRPEL2 MISSION shRNA shRNA Plasmid DNA
GrpE-like 2, mitochondrial (E. coli)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152407.3-625s21c1
Sequence:CCGGACACCCATTGGTGACAAATATCTCGAGATATTTGTCACCAATGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152407.3-300s21c1
Sequence:CCGGTGAACGAGCCTTAAGGGTAAACTCGAGTTTACCCTTAAGGCTCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152407.3-702s21c1
Sequence:CCGGTGGCACCGTGGCATTAGTAAGCTCGAGCTTACTAATGCCACGGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152407.3-1585s21c1
Sequence:CCGGATGGCTCTATTTGGGTAATTTCTCGAGAAATTACCCAAATAGAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152407.3-738s21c1
Sequence:CCGGACTTCATGGCCGCACCATTAGCTCGAGCTAATGGTGCGGCCATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152407.2-1011s1c1
Sequence:CCGGGCGGTCTCTATAACAGGAATTCTCGAGAATTCCTGTTATAGAGACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152407.2-595s1c1
Sequence:CCGGGTGGCATTAGTAAGACAAGATCTCGAGATCTTGTCTTACTAATGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152407.2-179s1c1
Sequence:CCGGCTCTTGCTGAACGAGCCTTAACTCGAGTTAAGGCTCGTTCAGCAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152407.2-318s1c1
Sequence:CCGGGATATTTGGAATCCAGAGTTTCTCGAGAAACTCTGGATTCCAAATATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152407.2-230s1c1
Sequence:CCGGTCCAAGATTTAACAGTGAGATCTCGAGATCTCACTGTTAAATCTTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152407
VALIDATED
GRPEL2 MISSION shRNA Lentiviral Transduction Particles
GrpE-like 2, mitochondrial (E. coli)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152407.3-625s21c1
Sequence:CCGGACACCCATTGGTGACAAATATCTCGAGATATTTGTCACCAATGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152407.3-300s21c1
Sequence:CCGGTGAACGAGCCTTAAGGGTAAACTCGAGTTTACCCTTAAGGCTCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152407.3-702s21c1
Sequence:CCGGTGGCACCGTGGCATTAGTAAGCTCGAGCTTACTAATGCCACGGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152407.3-1585s21c1
Sequence:CCGGATGGCTCTATTTGGGTAATTTCTCGAGAAATTACCCAAATAGAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152407.3-738s21c1
Sequence:CCGGACTTCATGGCCGCACCATTAGCTCGAGCTAATGGTGCGGCCATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152407.2-1011s1c1
Sequence:CCGGGCGGTCTCTATAACAGGAATTCTCGAGAATTCCTGTTATAGAGACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152407.2-595s1c1
Sequence:CCGGGTGGCATTAGTAAGACAAGATCTCGAGATCTTGTCTTACTAATGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152407.2-179s1c1
Sequence:CCGGCTCTTGCTGAACGAGCCTTAACTCGAGTTAAGGCTCGTTCAGCAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152407.2-318s1c1
Sequence:CCGGGATATTTGGAATCCAGAGTTTCTCGAGAAACTCTGGATTCCAAATATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152407.2-230s1c1
Sequence:CCGGTCCAAGATTTAACAGTGAGATCTCGAGATCTCACTGTTAAATCTTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks