EMAIL THIS PAGE TO A FRIEND

GRPR

gastrin-releasing peptide receptor

95 Gene Product Result for
UniProtKB ID: P30550, B2R910
Gene ID:
Human(2925) Summary: Gastrin-releasing peptide (GRP) regulates numerous functions of the gastrointestinal and central nervous systems, including release of gastrointestinal hormones, smooth muscle cell contraction, and epithelial cell proliferation and is a potent mitogen for neoplastic tissues. The effects of GRP are mediated through the gastrin-releasing peptide receptor. This receptor is a glycosylated, 7-transmembrane G-protein coupled receptor that activates the phospholipase C signaling pathway. The receptor is aberrantly expressed in numerous cancers such as those of the lung, colon, and prostate. An individual with autism and multiple exostoses was found to have a balanced translocation between chromosome 8 and a chromosome X breakpoint located within the gastrin-releasing peptide receptor gene. [provided by RefSeq, Jul 2008]
Mouse(14829) gastrin releasing peptide receptor
Rat(24938) gastrin releasing peptide receptor
Zebrafish(567289) gastrin-releasing peptide receptor
cow(532784) gastrin-releasing peptide receptor
Horse(100056400) gastrin-releasing peptide receptor
domestic cat(101096951) gastrin-releasing peptide receptor
dog(491754) gastrin-releasing peptide receptor
chicken(378928) gastrin-releasing peptide receptor
domestic guinea pig(100734491) gastrin-releasing peptide receptor
naked mole-rat(101701702) gastrin-releasing peptide receptor
sheep(100142675) gastrin-releasing peptide receptor
Domestic Rabbit(100344857) gastrin-releasing peptide receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
B4272 Bombesin acetate salt hydrate ≥97% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005314 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005314 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005314 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008177 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008177 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008177 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005314 Rosetta Predictions human pricing
NM_012706 Rosetta Predictions rat pricing
NM_008177 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005314 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103764 predicted 1765
2 SASI_Hs01_00103766 predicted 1072
3 SASI_Hs01_00103767 predicted 1319
4 SASI_Hs01_00103768 predicted 1415
5 SASI_Hs01_00103769 predicted 1336
6 SASI_Hs01_00103770 predicted 847
7 SASI_Hs01_00103771 predicted 1757
8 SASI_Hs01_00103772 predicted 870
9 SASI_Hs02_00339380 predicted 1543
10 SASI_Hs02_00339381 predicted 1673
11 SASI_Hs01_00103765 predicted 1115
12 SASI_Hs01_00103773 predicted 1910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012706 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260023 predicted 329
2 SASI_Rn02_00260024 predicted 450
3 SASI_Rn02_00260025 predicted 366
4 SASI_Rn02_00260026 predicted 939
5 SASI_Rn01_00067024 predicted 717
6 SASI_Rn02_00260027 predicted 1033
7 SASI_Rn02_00260028 predicted 271
8 SASI_Rn02_00260029 predicted 506
9 SASI_Rn02_00260030 predicted 709
10 SASI_Rn02_00260031 predicted 467
11 SASI_Rn01_00067020 predicted 325
12 SASI_Rn01_00067021 predicted 602
13 SASI_Rn01_00067022 predicted 249
14 SASI_Rn01_00067023 predicted 1177
15 SASI_Rn01_00067025 predicted 310
16 SASI_Rn01_00067026 predicted 704
17 SASI_Rn01_00067027 predicted 278
18 SASI_Rn01_00067028 predicted 756
19 SASI_Rn01_00067029 predicted 262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008177 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058990 predicted 806
2 SASI_Mm01_00058993 predicted 1458
3 SASI_Mm01_00058994 predicted 1017
4 SASI_Mm02_00313305 predicted 1375
5 SASI_Mm02_00313306 predicted 1059
6 SASI_Mm01_00058995 predicted 836
7 SASI_Mm01_00058996 predicted 843
8 SASI_Mm01_00058997 predicted 913
9 SASI_Mm01_00058998 predicted 533
10 SASI_Mm01_00058999 predicted 482
11 SASI_Mm01_00058991 predicted 772
12 SASI_Mm01_00058992 predicted 1573
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005314
GRPR MISSION shRNA Bacterial Glycerol Stock
gastrin-releasing peptide receptor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005314.1-1576s1c1
Sequence:CCGGTGAGGGACGGTTTTGCTTTATCTCGAGATAAAGCAAAACCGTCCCTCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005314.1-1503s1c1
Sequence:CCGGGCCACCTTTAGCCTCATCAATCTCGAGATTGATGAGGCTAAAGGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005314.1-440s1c1
Sequence:CCGGCCATTTCATGCACTGCAACATCTCGAGATGTTGCAGTGCATGAAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005314.1-1062s1c1
Sequence:CCGGCCACTGTCGATCATCTCTGTTCTCGAGAACAGAGATGATCGACAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005314.1-1119s1c1
Sequence:CCGGGCTTACAATCTTCCCGTGGAACTCGAGTTCCACGGGAAGATTGTAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005314.2-957s21c1
Sequence:CCGGCTGGCTGACAGATGGCTATTTCTCGAGAAATAGCCATCTGTCAGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005314.2-1792s21c1
Sequence:CCGGACGAGCGGTATGTCTAGATTGCTCGAGCAATCTAGACATACCGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005314.2-2213s21c1
Sequence:CCGGTAAGCAGACGCTAGTACTTTACTCGAGTAAAGTACTAGCGTCTGCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005314.2-1947s21c1
Sequence:CCGGCAAATGATGGATCACCATTATCTCGAGATAATGGTGATCCATCATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005314
GRPR MISSION shRNA shRNA Plasmid DNA
gastrin-releasing peptide receptor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005314.1-1576s1c1
Sequence:CCGGTGAGGGACGGTTTTGCTTTATCTCGAGATAAAGCAAAACCGTCCCTCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005314.1-1503s1c1
Sequence:CCGGGCCACCTTTAGCCTCATCAATCTCGAGATTGATGAGGCTAAAGGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005314.1-440s1c1
Sequence:CCGGCCATTTCATGCACTGCAACATCTCGAGATGTTGCAGTGCATGAAATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005314.1-1062s1c1
Sequence:CCGGCCACTGTCGATCATCTCTGTTCTCGAGAACAGAGATGATCGACAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005314.1-1119s1c1
Sequence:CCGGGCTTACAATCTTCCCGTGGAACTCGAGTTCCACGGGAAGATTGTAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005314.2-957s21c1
Sequence:CCGGCTGGCTGACAGATGGCTATTTCTCGAGAAATAGCCATCTGTCAGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005314.2-1792s21c1
Sequence:CCGGACGAGCGGTATGTCTAGATTGCTCGAGCAATCTAGACATACCGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005314.2-2213s21c1
Sequence:CCGGTAAGCAGACGCTAGTACTTTACTCGAGTAAAGTACTAGCGTCTGCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005314.2-1947s21c1
Sequence:CCGGCAAATGATGGATCACCATTATCTCGAGATAATGGTGATCCATCATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005314
GRPR MISSION shRNA Lentiviral Transduction Particles
gastrin-releasing peptide receptor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005314.1-1576s1c1
Sequence:CCGGTGAGGGACGGTTTTGCTTTATCTCGAGATAAAGCAAAACCGTCCCTCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005314.1-1503s1c1
Sequence:CCGGGCCACCTTTAGCCTCATCAATCTCGAGATTGATGAGGCTAAAGGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005314.1-440s1c1
Sequence:CCGGCCATTTCATGCACTGCAACATCTCGAGATGTTGCAGTGCATGAAATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005314.1-1062s1c1
Sequence:CCGGCCACTGTCGATCATCTCTGTTCTCGAGAACAGAGATGATCGACAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005314.1-1119s1c1
Sequence:CCGGGCTTACAATCTTCCCGTGGAACTCGAGTTCCACGGGAAGATTGTAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005314.2-957s21c1
Sequence:CCGGCTGGCTGACAGATGGCTATTTCTCGAGAAATAGCCATCTGTCAGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005314.2-1792s21c1
Sequence:CCGGACGAGCGGTATGTCTAGATTGCTCGAGCAATCTAGACATACCGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005314.2-2213s21c1
Sequence:CCGGTAAGCAGACGCTAGTACTTTACTCGAGTAAAGTACTAGCGTCTGCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005314.2-1947s21c1
Sequence:CCGGCAAATGATGGATCACCATTATCTCGAGATAATGGTGATCCATCATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008177
GRPR MISSION shRNA Bacterial Glycerol Stock
gastrin-releasing peptide receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008177.1-1040s1c1
Sequence:CCGGCTACTACTTCATTGCCCGAAACTCGAGTTTCGGGCAATGAAGTAGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008177.1-762s1c1
Sequence:CCGGGACAGGTACAAAGCCATTGTACTCGAGTACAATGGCTTTGTACCTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008177.1-482s1c1
Sequence:CCGGCCCTGCAGTTTATGGGCTTATCTCGAGATAAGCCCATAAACTGCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008177.1-1346s1c1
Sequence:CCGGGCAGTTCAACACTCAACTTCTCTCGAGAGAAGTTGAGTGTTGAACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008177.1-919s1c1
Sequence:CCGGCCAACCAAACCTTCATTAGTTCTCGAGAACTAATGAAGGTTTGGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008177
GRPR MISSION shRNA shRNA Plasmid DNA
gastrin-releasing peptide receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008177.1-1040s1c1
Sequence:CCGGCTACTACTTCATTGCCCGAAACTCGAGTTTCGGGCAATGAAGTAGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008177.1-762s1c1
Sequence:CCGGGACAGGTACAAAGCCATTGTACTCGAGTACAATGGCTTTGTACCTGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008177.1-482s1c1
Sequence:CCGGCCCTGCAGTTTATGGGCTTATCTCGAGATAAGCCCATAAACTGCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008177.1-1346s1c1
Sequence:CCGGGCAGTTCAACACTCAACTTCTCTCGAGAGAAGTTGAGTGTTGAACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008177.1-919s1c1
Sequence:CCGGCCAACCAAACCTTCATTAGTTCTCGAGAACTAATGAAGGTTTGGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008177
GRPR MISSION shRNA Lentiviral Transduction Particles
gastrin-releasing peptide receptor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008177.1-1040s1c1
Sequence:CCGGCTACTACTTCATTGCCCGAAACTCGAGTTTCGGGCAATGAAGTAGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008177.1-762s1c1
Sequence:CCGGGACAGGTACAAAGCCATTGTACTCGAGTACAATGGCTTTGTACCTGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008177.1-482s1c1
Sequence:CCGGCCCTGCAGTTTATGGGCTTATCTCGAGATAAGCCCATAAACTGCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008177.1-1346s1c1
Sequence:CCGGGCAGTTCAACACTCAACTTCTCTCGAGAGAAGTTGAGTGTTGAACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008177.1-919s1c1
Sequence:CCGGCCAACCAAACCTTCATTAGTTCTCGAGAACTAATGAAGGTTTGGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)