EMAIL THIS PAGE TO A FRIEND

GRSF1

G-rich RNA sequence binding factor 1

UniProtKB ID: Q12849, B3KPW0, Q4W5S5, Q6ZST3, Q8IWD6, Q8NBD2
Gene ID:
Human(2926) Summary: The protein encoded by this gene is a cellular protein that binds RNAs containing the G-rich element. The protein is localized in the cytoplasm, and has been shown to stimulate translation of viral mRNAs in vitro. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(231413) G-rich RNA sequence binding factor 1
Rat(305256) G-rich RNA sequence binding factor 1
Zebrafish(563249) G-rich RNA sequence binding factor 1
chicken(422646) G-rich RNA sequence binding factor 1
cow(527169) G-rich RNA sequence binding factor 1
Horse(100054436) G-rich RNA sequence binding factor 1
domestic cat(101084360) G-rich RNA sequence binding factor 1
dog(475170) G-rich RNA sequence binding factor 1
sheep(101122864) G-rich RNA sequence binding factor 1
domestic guinea pig(100731454) G-rich RNA sequence binding factor 1
naked mole-rat(101720791) G-rich RNA sequence binding factor 1
96 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178700 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178700 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178700 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002092 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002092 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002092 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098477 Rosetta Predictions human pricing
NM_002092 Rosetta Predictions human pricing
XM_001073361 Rosetta Predictions rat pricing
XM_223327 Rosetta Predictions rat pricing
NM_001098476 Rosetta Predictions mouse pricing
NM_178700 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098477 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318939 predicted 826
2 SASI_Hs02_00318940 predicted 1300
3 SASI_Hs02_00318941 predicted 1389
4 SASI_Hs02_00318942 predicted 636
5 SASI_Hs02_00318943 predicted 1196
6 SASI_Hs02_00318944 predicted 1429
7 SASI_Hs02_00318945 predicted 674
8 SASI_Hs02_00318946 predicted 569
9 SASI_Hs02_00318947 predicted 1376
10 SASI_Hs02_00318948 predicted 796
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002092 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225115 predicted 987
2 SASI_Hs02_00333184 predicted 1468
3 SASI_Hs01_00225117 predicted 1554
4 SASI_Hs02_00333185 predicted 797
5 SASI_Hs01_00225119 predicted 1353
6 SASI_Hs01_00225120 predicted 1588
7 SASI_Hs02_00333186 predicted 836
8 SASI_Hs01_00225121 predicted 737
9 SASI_Hs02_00333187 predicted 1537
10 SASI_Hs02_00333188 predicted 959
11 SASI_Hs01_00225116 predicted 702
12 SASI_Hs01_00225118 predicted 374
13 SASI_Hs01_00225122 predicted 1296
14 SASI_Hs01_00225123 predicted 1096
15 SASI_Hs01_00225124 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073361 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342525 predicted 1353
2 SASI_Rn02_00342526 predicted 1911
3 SASI_Rn02_00342527 predicted 1399
4 SASI_Rn02_00342528 predicted 1188
5 SASI_Rn02_00342529 predicted 1232
6 SASI_Rn02_00342530 predicted 902
7 SASI_Rn02_00342531 predicted 1832
8 SASI_Rn02_00342532 predicted 1360
9 SASI_Rn02_00342533 predicted 1031
10 SASI_Rn02_00342534 predicted 1451
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223327 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381265 predicted 1643
2 SASI_Rn02_00381266 predicted 1690
3 SASI_Rn02_00381267 predicted 1483
4 SASI_Rn02_00381268 predicted 1526
5 SASI_Rn02_00381269 predicted 1198
6 SASI_Rn02_00381270 predicted 1510
7 SASI_Rn02_00381271 predicted 1653
8 SASI_Rn02_00381272 predicted 1330
9 SASI_Rn02_00381273 predicted 1743
10 SASI_Rn02_00381274 predicted 1248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098476 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301391 predicted 646
2 SASI_Mm02_00301392 predicted 539
3 SASI_Mm02_00301393 predicted 540
4 SASI_Mm02_00301394 predicted 848
5 SASI_Mm02_00301395 predicted 785
6 SASI_Mm02_00301396 predicted 529
7 SASI_Mm02_00301397 predicted 1139
8 SASI_Mm02_00301398 predicted 494
9 SASI_Mm02_00301399 predicted 949
10 SASI_Mm02_00301400 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178700 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135663 predicted 966
2 SASI_Mm01_00135665 predicted 863
3 SASI_Mm02_00349197 predicted 870
4 SASI_Mm02_00349198 predicted 1177
5 SASI_Mm01_00135666 predicted 1120
6 SASI_Mm02_00349199 predicted 851
7 SASI_Mm01_00135667 predicted 1466
8 SASI_Mm01_00135669 predicted 823
9 SASI_Mm01_00135670 predicted 1275
10 SASI_Mm01_00135672 predicted 713
11 SASI_Mm01_00135664 predicted 604
12 SASI_Mm01_00135668 predicted 491
13 SASI_Mm01_00135671 predicted 608
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178700
VALIDATED
GRSF1 MISSION shRNA Bacterial Glycerol Stock
G-rich RNA sequence binding factor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178700.4-715s21c1
Sequence:CCGGCGGTATGTGGAAGTGTATGAACTCGAGTTCATACACTTCCACATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178700.4-1931s21c1
Sequence:CCGGCCAGTCTGATTTGGTCAAATACTCGAGTATTTGACCAAATCAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178700.4-1442s21c1
Sequence:CCGGCCCATGTCCAACATAGGTATACTCGAGTATACCTATGTTGGACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178700.4-1082s21c1
Sequence:CCGGCATCGTCTCCTCCTACTAAATCTCGAGATTTAGTAGGAGGAGACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178700.4-872s21c1
Sequence:CCGGGACTGAACATAGTAGACATTACTCGAGTAATGTCTACTATGTTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109075    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178700.2-1932s1c1
Sequence:CCGGCCAGTCTGATTTGGTCAAATACTCGAGTATTTGACCAAATCAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178700.2-713s1c1
Sequence:CCGGCAGCGGTATGTGGAAGTGTATCTCGAGATACACTTCCACATACCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178700.2-1443s1c1
Sequence:CCGGCCCATGTCCAACATAGGTATACTCGAGTATACCTATGTTGGACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178700.2-610s1c1
Sequence:CCGGCCTCCTAAATAGAGATGGGAACTCGAGTTCCCATCTCTATTTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178700.2-716s1c1
Sequence:CCGGCGGTATGTGGAAGTGTATGAACTCGAGTTCATACACTTCCACATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178700
VALIDATED
GRSF1 MISSION shRNA shRNA Plasmid DNA
G-rich RNA sequence binding factor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178700.4-715s21c1
Sequence:CCGGCGGTATGTGGAAGTGTATGAACTCGAGTTCATACACTTCCACATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178700.4-1931s21c1
Sequence:CCGGCCAGTCTGATTTGGTCAAATACTCGAGTATTTGACCAAATCAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178700.4-1442s21c1
Sequence:CCGGCCCATGTCCAACATAGGTATACTCGAGTATACCTATGTTGGACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178700.4-1082s21c1
Sequence:CCGGCATCGTCTCCTCCTACTAAATCTCGAGATTTAGTAGGAGGAGACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178700.4-872s21c1
Sequence:CCGGGACTGAACATAGTAGACATTACTCGAGTAATGTCTACTATGTTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109075    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178700.2-1932s1c1
Sequence:CCGGCCAGTCTGATTTGGTCAAATACTCGAGTATTTGACCAAATCAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178700.2-713s1c1
Sequence:CCGGCAGCGGTATGTGGAAGTGTATCTCGAGATACACTTCCACATACCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178700.2-1443s1c1
Sequence:CCGGCCCATGTCCAACATAGGTATACTCGAGTATACCTATGTTGGACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178700.2-610s1c1
Sequence:CCGGCCTCCTAAATAGAGATGGGAACTCGAGTTCCCATCTCTATTTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178700.2-716s1c1
Sequence:CCGGCGGTATGTGGAAGTGTATGAACTCGAGTTCATACACTTCCACATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178700
VALIDATED
GRSF1 MISSION shRNA Lentiviral Transduction Particles
G-rich RNA sequence binding factor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178700.4-715s21c1
Sequence:CCGGCGGTATGTGGAAGTGTATGAACTCGAGTTCATACACTTCCACATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178700.4-1931s21c1
Sequence:CCGGCCAGTCTGATTTGGTCAAATACTCGAGTATTTGACCAAATCAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178700.4-1442s21c1
Sequence:CCGGCCCATGTCCAACATAGGTATACTCGAGTATACCTATGTTGGACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178700.4-1082s21c1
Sequence:CCGGCATCGTCTCCTCCTACTAAATCTCGAGATTTAGTAGGAGGAGACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178700.4-872s21c1
Sequence:CCGGGACTGAACATAGTAGACATTACTCGAGTAATGTCTACTATGTTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109075    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178700.2-1932s1c1
Sequence:CCGGCCAGTCTGATTTGGTCAAATACTCGAGTATTTGACCAAATCAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178700.2-713s1c1
Sequence:CCGGCAGCGGTATGTGGAAGTGTATCTCGAGATACACTTCCACATACCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178700.2-1443s1c1
Sequence:CCGGCCCATGTCCAACATAGGTATACTCGAGTATACCTATGTTGGACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178700.2-610s1c1
Sequence:CCGGCCTCCTAAATAGAGATGGGAACTCGAGTTCCCATCTCTATTTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178700.2-716s1c1
Sequence:CCGGCGGTATGTGGAAGTGTATGAACTCGAGTTCATACACTTCCACATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002092
VALIDATED
GRSF1 MISSION shRNA Bacterial Glycerol Stock
G-rich RNA sequence binding factor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002092.3-1470s21c1
Sequence:CCGGCACGTTCATCATAGGTATATTCTCGAGAATATACCTATGATGAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002092.3-1323s21c1
Sequence:CCGGGCCCAAGACATTATAAACTTTCTCGAGAAAGTTTATAATGTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002092.3-614s21c1
Sequence:CCGGCGGTGAGAATGGAATACATTTCTCGAGAAATGTATTCCATTCTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002092.3-1838s21c1
Sequence:CCGGTCATTGTAAAGACCACATATTCTCGAGAATATGTGGTCTTTACAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_002092.3-1028s21c1
Sequence:CCGGTAATCGATACATCGAGATATTCTCGAGAATATCTCGATGTATCGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002092.2-1778s1c1
Sequence:CCGGCCAAACATTCACCAAAGCAAACTCGAGTTTGCTTTGGTGAATGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002092.2-416s1c1
Sequence:CCGGCGGTGAGAATGGAATACATTTCTCGAGAAATGTATTCCATTCTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002092.2-1125s1c1
Sequence:CCGGGCCCAAGACATTATAAACTTTCTCGAGAAAGTTTATAATGTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002092.2-437s1c1
Sequence:CCGGTCTCCTAAACAGAGATGGGAACTCGAGTTCCCATCTCTGTTTAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002092.2-884s1c1
Sequence:CCGGCGGTTCTTATAAGGGAAAGAACTCGAGTTCTTTCCCTTATAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002092
VALIDATED
GRSF1 MISSION shRNA shRNA Plasmid DNA
G-rich RNA sequence binding factor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002092.3-1470s21c1
Sequence:CCGGCACGTTCATCATAGGTATATTCTCGAGAATATACCTATGATGAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002092.3-1323s21c1
Sequence:CCGGGCCCAAGACATTATAAACTTTCTCGAGAAAGTTTATAATGTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002092.3-614s21c1
Sequence:CCGGCGGTGAGAATGGAATACATTTCTCGAGAAATGTATTCCATTCTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002092.3-1838s21c1
Sequence:CCGGTCATTGTAAAGACCACATATTCTCGAGAATATGTGGTCTTTACAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_002092.3-1028s21c1
Sequence:CCGGTAATCGATACATCGAGATATTCTCGAGAATATCTCGATGTATCGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002092.2-1778s1c1
Sequence:CCGGCCAAACATTCACCAAAGCAAACTCGAGTTTGCTTTGGTGAATGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002092.2-416s1c1
Sequence:CCGGCGGTGAGAATGGAATACATTTCTCGAGAAATGTATTCCATTCTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002092.2-1125s1c1
Sequence:CCGGGCCCAAGACATTATAAACTTTCTCGAGAAAGTTTATAATGTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002092.2-437s1c1
Sequence:CCGGTCTCCTAAACAGAGATGGGAACTCGAGTTCCCATCTCTGTTTAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002092.2-884s1c1
Sequence:CCGGCGGTTCTTATAAGGGAAAGAACTCGAGTTCTTTCCCTTATAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002092
VALIDATED
GRSF1 MISSION shRNA Lentiviral Transduction Particles
G-rich RNA sequence binding factor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002092.3-1470s21c1
Sequence:CCGGCACGTTCATCATAGGTATATTCTCGAGAATATACCTATGATGAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002092.3-1323s21c1
Sequence:CCGGGCCCAAGACATTATAAACTTTCTCGAGAAAGTTTATAATGTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002092.3-614s21c1
Sequence:CCGGCGGTGAGAATGGAATACATTTCTCGAGAAATGTATTCCATTCTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002092.3-1838s21c1
Sequence:CCGGTCATTGTAAAGACCACATATTCTCGAGAATATGTGGTCTTTACAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_002092.3-1028s21c1
Sequence:CCGGTAATCGATACATCGAGATATTCTCGAGAATATCTCGATGTATCGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002092.2-1778s1c1
Sequence:CCGGCCAAACATTCACCAAAGCAAACTCGAGTTTGCTTTGGTGAATGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002092.2-416s1c1
Sequence:CCGGCGGTGAGAATGGAATACATTTCTCGAGAAATGTATTCCATTCTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002092.2-1125s1c1
Sequence:CCGGGCCCAAGACATTATAAACTTTCTCGAGAAAGTTTATAATGTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002092.2-437s1c1
Sequence:CCGGTCTCCTAAACAGAGATGGGAACTCGAGTTCCCATCTCTGTTTAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002092.2-884s1c1
Sequence:CCGGCGGTTCTTATAAGGGAAAGAACTCGAGTTCTTTCCCTTATAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks