EMAIL THIS PAGE TO A FRIEND

GRTP1

growth hormone regulated TBC protein 1

43 Gene Product Result for
Synonyms: TBC1D6
Gene ID:
Mouse(66790) GH regulated TBC protein 1
Rat(361180) growth hormone regulated TBC protein 1
chicken(418742) growth hormone regulated TBC protein 1
dog(476996) growth hormone regulated TBC protein 1
cow(100125303) growth hormone regulated TBC protein 1
domestic guinea pig(100726331) growth hormone regulated TBC protein 1
naked mole-rat(101700344) growth hormone regulated TBC protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024719 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024719 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024719 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025768 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025768 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025768 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024719 Rosetta Predictions human pricing
NM_025768 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024719 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170870 predicted 841
2 SASI_Hs01_00170871 predicted 937
3 SASI_Hs01_00170872 predicted 837
4 SASI_Hs02_00357184 predicted 941
5 SASI_Hs02_00357185 predicted 419
6 SASI_Hs02_00357186 predicted 573
7 SASI_Hs02_00357187 predicted 1169
8 SASI_Hs02_00357188 predicted 942
9 SASI_Hs01_00170878 predicted 622
10 SASI_Hs02_00357189 predicted 841
11 SASI_Hs01_00170869 predicted 638
12 SASI_Hs01_00170873 predicted 765
13 SASI_Hs01_00170874 predicted 842
14 SASI_Hs01_00170875 predicted 896
15 SASI_Hs01_00170876 predicted 643
16 SASI_Hs01_00170877 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025768 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100988 predicted 901
2 SASI_Mm01_00100989 predicted 441
3 SASI_Mm01_00100990 predicted 899
4 SASI_Mm01_00100991 predicted 296
5 SASI_Mm01_00100992 predicted 235
6 SASI_Mm01_00100993 predicted 265
7 SASI_Mm01_00100994 predicted 569
8 SASI_Mm01_00100996 predicted 462
9 SASI_Mm01_00100997 predicted 809
10 SASI_Mm02_00328964 predicted 300
11 SASI_Mm01_00100995 predicted 858
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024719
VALIDATED
GRTP1 MISSION shRNA Bacterial Glycerol Stock
growth hormone regulated TBC protein 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024719.1-586s1c1
Sequence:CCGGCGTTCCAGACATTTGCGATAACTCGAGTTATCGCAAATGTCTGGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155508    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024719.1-1168s1c1
Sequence:CCGGCCTTCATCAAAGAGAAGACCACTCGAGTGGTCTTCTCTTTGATGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024719.1-508s1c1
Sequence:CCGGCGAAGGCTCGAAGATTATCTTCTCGAGAAGATAATCTTCGAGCCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024719.1-275s1c1
Sequence:CCGGGATGCTCTTGTTGGAAGAATACTCGAGTATTCTTCCAACAAGAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024719.1-1172s1c1
Sequence:CCGGCATCAAAGAGAAGACCATGTTCTCGAGAACATGGTCTTCTCTTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024719.1-988s1c1
Sequence:CCGGCGTATAGACTCAGGTCCTGATCTCGAGATCAGGACCTGAGTCTATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024719.1-613s1c1
Sequence:CCGGGCAGATAACCAAAGGGAGCTTCTCGAGAAGCTCCCTTTGGTTATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024719.2-865s21c1
Sequence:CCGGCGAAGGCTCGAAGATTATCTTCTCGAGAAGATAATCTTCGAGCCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024719.2-943s21c1
Sequence:CCGGCGTTCCAGACATTTGCGATAACTCGAGTTATCGCAAATGTCTGGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024719.2-995s21c1
Sequence:CCGGATGGAGTGTCACACGTTTATGCTCGAGCATAAACGTGTGACACTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024719.2-643s21c1
Sequence:CCGGTGGAAGAATACTACCAGATTACTCGAGTAATCTGGTAGTATTCTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024719.2-1211s21c1
Sequence:CCGGACTTGACATCACTACACTTTACTCGAGTAAAGTGTAGTGATGTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024719
VALIDATED
GRTP1 MISSION shRNA shRNA Plasmid DNA
growth hormone regulated TBC protein 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024719.1-586s1c1
Sequence:CCGGCGTTCCAGACATTTGCGATAACTCGAGTTATCGCAAATGTCTGGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155508    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024719.1-1168s1c1
Sequence:CCGGCCTTCATCAAAGAGAAGACCACTCGAGTGGTCTTCTCTTTGATGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024719.1-508s1c1
Sequence:CCGGCGAAGGCTCGAAGATTATCTTCTCGAGAAGATAATCTTCGAGCCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024719.1-275s1c1
Sequence:CCGGGATGCTCTTGTTGGAAGAATACTCGAGTATTCTTCCAACAAGAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024719.1-1172s1c1
Sequence:CCGGCATCAAAGAGAAGACCATGTTCTCGAGAACATGGTCTTCTCTTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024719.1-988s1c1
Sequence:CCGGCGTATAGACTCAGGTCCTGATCTCGAGATCAGGACCTGAGTCTATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024719.1-613s1c1
Sequence:CCGGGCAGATAACCAAAGGGAGCTTCTCGAGAAGCTCCCTTTGGTTATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024719.2-865s21c1
Sequence:CCGGCGAAGGCTCGAAGATTATCTTCTCGAGAAGATAATCTTCGAGCCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024719.2-943s21c1
Sequence:CCGGCGTTCCAGACATTTGCGATAACTCGAGTTATCGCAAATGTCTGGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024719.2-995s21c1
Sequence:CCGGATGGAGTGTCACACGTTTATGCTCGAGCATAAACGTGTGACACTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024719.2-643s21c1
Sequence:CCGGTGGAAGAATACTACCAGATTACTCGAGTAATCTGGTAGTATTCTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024719.2-1211s21c1
Sequence:CCGGACTTGACATCACTACACTTTACTCGAGTAAAGTGTAGTGATGTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024719
VALIDATED
GRTP1 MISSION shRNA Lentiviral Transduction Particles
growth hormone regulated TBC protein 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024719.1-586s1c1
Sequence:CCGGCGTTCCAGACATTTGCGATAACTCGAGTTATCGCAAATGTCTGGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155508    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024719.1-1168s1c1
Sequence:CCGGCCTTCATCAAAGAGAAGACCACTCGAGTGGTCTTCTCTTTGATGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024719.1-508s1c1
Sequence:CCGGCGAAGGCTCGAAGATTATCTTCTCGAGAAGATAATCTTCGAGCCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024719.1-275s1c1
Sequence:CCGGGATGCTCTTGTTGGAAGAATACTCGAGTATTCTTCCAACAAGAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024719.1-1172s1c1
Sequence:CCGGCATCAAAGAGAAGACCATGTTCTCGAGAACATGGTCTTCTCTTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024719.1-988s1c1
Sequence:CCGGCGTATAGACTCAGGTCCTGATCTCGAGATCAGGACCTGAGTCTATACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024719.1-613s1c1
Sequence:CCGGGCAGATAACCAAAGGGAGCTTCTCGAGAAGCTCCCTTTGGTTATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024719.2-865s21c1
Sequence:CCGGCGAAGGCTCGAAGATTATCTTCTCGAGAAGATAATCTTCGAGCCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024719.2-943s21c1
Sequence:CCGGCGTTCCAGACATTTGCGATAACTCGAGTTATCGCAAATGTCTGGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024719.2-995s21c1
Sequence:CCGGATGGAGTGTCACACGTTTATGCTCGAGCATAAACGTGTGACACTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024719.2-643s21c1
Sequence:CCGGTGGAAGAATACTACCAGATTACTCGAGTAATCTGGTAGTATTCTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024719.2-1211s21c1
Sequence:CCGGACTTGACATCACTACACTTTACTCGAGTAAAGTGTAGTGATGTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025768
GRTP1 MISSION shRNA Bacterial Glycerol Stock
growth hormone regulated TBC protein 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000106225    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025768.1-1120s1c1
Sequence:CCGGCAGAGCACACACTTCACCAATCTCGAGATTGGTGAAGTGTGTGCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025768.1-567s1c1
Sequence:CCGGCTGATCCTTATCACGAAGAATCTCGAGATTCTTCGTGATAAGGATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025768.1-867s1c1
Sequence:CCGGCGGGTTGCTCTGACCTTAATTCTCGAGAATTAAGGTCAGAGCAACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025768.1-150s1c1
Sequence:CCGGGCGATCAAATGGTCCAAACTTCTCGAGAAGTTTGGACCATTTGATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025768
GRTP1 MISSION shRNA shRNA Plasmid DNA
growth hormone regulated TBC protein 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000106225    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025768.1-1120s1c1
Sequence:CCGGCAGAGCACACACTTCACCAATCTCGAGATTGGTGAAGTGTGTGCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025768.1-567s1c1
Sequence:CCGGCTGATCCTTATCACGAAGAATCTCGAGATTCTTCGTGATAAGGATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025768.1-867s1c1
Sequence:CCGGCGGGTTGCTCTGACCTTAATTCTCGAGAATTAAGGTCAGAGCAACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025768.1-150s1c1
Sequence:CCGGGCGATCAAATGGTCCAAACTTCTCGAGAAGTTTGGACCATTTGATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025768
GRTP1 MISSION shRNA Lentiviral Transduction Particles
growth hormone regulated TBC protein 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000106225    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025768.1-1120s1c1
Sequence:CCGGCAGAGCACACACTTCACCAATCTCGAGATTGGTGAAGTGTGTGCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025768.1-567s1c1
Sequence:CCGGCTGATCCTTATCACGAAGAATCTCGAGATTCTTCGTGATAAGGATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025768.1-867s1c1
Sequence:CCGGCGGGTTGCTCTGACCTTAATTCTCGAGAATTAAGGTCAGAGCAACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025768.1-150s1c1
Sequence:CCGGGCGATCAAATGGTCCAAACTTCTCGAGAAGTTTGGACCATTTGATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)