EMAIL THIS PAGE TO A FRIEND

GRWD1

glutamate-rich WD repeat containing 1

73 Gene Product Result for
Synonyms: CDW4 GRWD RRB1 WDR28
UniProtKB ID: Q9BQ67, Q8TF59
Gene ID:
Human(83743) Summary: This gene encodes a glutamate-rich protein that contains five WD-repeat motifs. The encoded protein may play a critical role in ribosome biogenesis and may also play a role in histone methylation through interactions with CUL4-DDB1 ubiquitin E3 ligase. [provided by RefSeq, Feb 2012]
Mouse(101612) glutamate-rich WD repeat containing 1
Rat(308592) glutamate-rich WD repeat containing 1
Zebrafish(445115) glutamate-rich WD repeat containing 1
dog(612058) glutamate-rich WD repeat containing 1
domestic cat(101089227) glutamate-rich WD repeat containing 1
cow(540739) glutamate-rich WD repeat containing 1
Horse(100051020) glutamate-rich WD repeat containing 1
sheep(101122298) glutamate-rich WD repeat containing 1
domestic guinea pig(100733019) glutamate-rich WD repeat containing 1
naked mole-rat(101726377) glutamate-rich WD repeat containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153419 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153419 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153419 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031485 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031485 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031485 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031485 Rosetta Predictions human pricing
NM_001012067 Rosetta Predictions rat pricing
XM_577803 Rosetta Predictions rat pricing
NM_153419 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031485 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358921 predicted 879
2 SASI_Hs01_00183662 predicted 1570
3 SASI_Hs01_00183663 predicted 1203
4 SASI_Hs01_00183664 predicted 1025
5 SASI_Hs01_00183665 predicted 1302
6 SASI_Hs02_00358922 predicted 1545
7 SASI_Hs01_00183666 predicted 1001
8 SASI_Hs01_00183667 predicted 1501
9 SASI_Hs01_00183669 predicted 1321
10 SASI_Hs01_00183670 predicted 1534
11 SASI_Hs01_00183668 predicted 815
12 SASI_Hs01_00183671 predicted 820
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012067 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060441 predicted 218
2 SASI_Rn01_00060442 predicted 658
3 SASI_Rn01_00060443 predicted 1166
4 SASI_Rn01_00060444 predicted 271
5 SASI_Rn01_00060445 predicted 347
6 SASI_Rn01_00060446 predicted 1041
7 SASI_Rn01_00060447 predicted 747
8 SASI_Rn02_00200174 predicted 1383
9 SASI_Rn02_00200175 predicted 979
10 SASI_Rn01_00060448 predicted 1438
11 SASI_Rn01_00060449 predicted 444
12 SASI_Rn01_00060450 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577803 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00165553 predicted 759
2 SASI_Rn01_00165554 predicted 979
3 SASI_Rn01_00165555 predicted 559
4 SASI_Rn01_00165556 predicted 675
5 SASI_Rn01_00165557 predicted 699
6 SASI_Rn01_00165558 predicted 996
7 SASI_Rn01_00165559 predicted 992
8 SASI_Rn01_00165560 predicted 866
9 SASI_Rn01_00165561 predicted 575
10 SASI_Rn01_00165562 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153419 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096417 predicted 1124
2 SASI_Mm02_00343209 predicted 1338
3 SASI_Mm02_00343210 predicted 303
4 SASI_Mm01_00096421 predicted 593
5 SASI_Mm02_00343211 predicted 208
6 SASI_Mm01_00096423 predicted 1393
7 SASI_Mm02_00343212 predicted 308
8 SASI_Mm02_00343213 predicted 217
9 SASI_Mm01_00096424 predicted 439
10 SASI_Mm01_00096425 predicted 711
11 SASI_Mm01_00096418 predicted 1369
12 SASI_Mm01_00096419 predicted 1357
13 SASI_Mm01_00096420 predicted 1355
14 SASI_Mm01_00096422 predicted 868
15 SASI_Mm01_00096426 predicted 1233
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153419
VALIDATED
GRWD1 MISSION shRNA Bacterial Glycerol Stock
glutamate-rich WD repeat containing 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153419.2-602s21c1
Sequence:CCGGAGATGAGCAGGCCCGAATAAACTCGAGTTTATTCGGGCCTGCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153419.2-1009s21c1
Sequence:CCGGTCTGGGACCTGCGACAGTTTACTCGAGTAAACTGTCGCAGGTCCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153419.2-251s21c1
Sequence:CCGGAGAGCTCCCTCTCAGTCTTTACTCGAGTAAAGACTGAGAGGGAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250917    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153419.2-1401s21c1
Sequence:CCGGTTAACTTGGCAAGGATCATTACTCGAGTAATGATCCTTGCCAAGTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153419.2-820s21c1
Sequence:CCGGCAACTGAGGACACGGTGTTTGCTCGAGCAAACACCGTGTCCTCAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176207    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153419.1-1521s1c1
Sequence:CCGGGACCTAATTCTGGCTGTTGATCTCGAGATCAACAGCCAGAATTAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153419.1-1002s1c1
Sequence:CCGGCAACCAGATCACACAATGGGACTCGAGTCCCATTGTGTGATCTGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153419
VALIDATED
GRWD1 MISSION shRNA shRNA Plasmid DNA
glutamate-rich WD repeat containing 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153419.2-602s21c1
Sequence:CCGGAGATGAGCAGGCCCGAATAAACTCGAGTTTATTCGGGCCTGCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153419.2-1009s21c1
Sequence:CCGGTCTGGGACCTGCGACAGTTTACTCGAGTAAACTGTCGCAGGTCCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153419.2-251s21c1
Sequence:CCGGAGAGCTCCCTCTCAGTCTTTACTCGAGTAAAGACTGAGAGGGAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250917    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153419.2-1401s21c1
Sequence:CCGGTTAACTTGGCAAGGATCATTACTCGAGTAATGATCCTTGCCAAGTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153419.2-820s21c1
Sequence:CCGGCAACTGAGGACACGGTGTTTGCTCGAGCAAACACCGTGTCCTCAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176207    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153419.1-1521s1c1
Sequence:CCGGGACCTAATTCTGGCTGTTGATCTCGAGATCAACAGCCAGAATTAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153419.1-1002s1c1
Sequence:CCGGCAACCAGATCACACAATGGGACTCGAGTCCCATTGTGTGATCTGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153419
VALIDATED
GRWD1 MISSION shRNA Lentiviral Transduction Particles
glutamate-rich WD repeat containing 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153419.2-602s21c1
Sequence:CCGGAGATGAGCAGGCCCGAATAAACTCGAGTTTATTCGGGCCTGCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153419.2-1009s21c1
Sequence:CCGGTCTGGGACCTGCGACAGTTTACTCGAGTAAACTGTCGCAGGTCCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153419.2-251s21c1
Sequence:CCGGAGAGCTCCCTCTCAGTCTTTACTCGAGTAAAGACTGAGAGGGAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250917    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153419.2-1401s21c1
Sequence:CCGGTTAACTTGGCAAGGATCATTACTCGAGTAATGATCCTTGCCAAGTTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153419.2-820s21c1
Sequence:CCGGCAACTGAGGACACGGTGTTTGCTCGAGCAAACACCGTGTCCTCAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176207    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153419.1-1521s1c1
Sequence:CCGGGACCTAATTCTGGCTGTTGATCTCGAGATCAACAGCCAGAATTAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153419.1-1002s1c1
Sequence:CCGGCAACCAGATCACACAATGGGACTCGAGTCCCATTGTGTGATCTGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031485
VALIDATED
GRWD1 MISSION shRNA Bacterial Glycerol Stock
glutamate-rich WD repeat containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031485.2-495s1c1
Sequence:CCGGCCAGAGCAACAGACTGATGATCTCGAGATCATCAGTCTGTTGCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031485.2-510s1c1
Sequence:CCGGGATGATGCTTCTGATGCACAACTCGAGTTGTGCATCAGAAGCATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031485.2-1719s1c1
Sequence:CCGGCTCACCAAAGAACTCGGTTTACTCGAGTAAACCGAGTTCTTTGGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031485.2-517s1c1
Sequence:CCGGCTTCTGATGCACAATCTGCATCTCGAGATGCAGATTGTGCATCAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031485.2-583s1c1
Sequence:CCGGGAGGAAGATGAAGAGGATGAACTCGAGTTCATCCTCTTCATCTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031485.2-568s1c1
Sequence:CCGGGATGAAGAAGAAGAGGAGGAACTCGAGTTCCTCCTCTTCTTCTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_031485.2-598s1c1
Sequence:CCGGGATGAAGAAGAGCGGAAACCTCTCGAGAGGTTTCCGCTCTTCTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031485.2-1573s1c1
Sequence:CCGGGCTTGGAAACTGAAGTCGAATCTCGAGATTCGACTTCAGTTTCCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031485.2-574s1c1
Sequence:CCGGGAAGAAGAGGAGGAAGATGAACTCGAGTTCATCTTCCTCCTCTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031485
VALIDATED
GRWD1 MISSION shRNA shRNA Plasmid DNA
glutamate-rich WD repeat containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031485.2-495s1c1
Sequence:CCGGCCAGAGCAACAGACTGATGATCTCGAGATCATCAGTCTGTTGCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031485.2-510s1c1
Sequence:CCGGGATGATGCTTCTGATGCACAACTCGAGTTGTGCATCAGAAGCATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031485.2-1719s1c1
Sequence:CCGGCTCACCAAAGAACTCGGTTTACTCGAGTAAACCGAGTTCTTTGGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031485.2-517s1c1
Sequence:CCGGCTTCTGATGCACAATCTGCATCTCGAGATGCAGATTGTGCATCAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031485.2-583s1c1
Sequence:CCGGGAGGAAGATGAAGAGGATGAACTCGAGTTCATCCTCTTCATCTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031485.2-568s1c1
Sequence:CCGGGATGAAGAAGAAGAGGAGGAACTCGAGTTCCTCCTCTTCTTCTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_031485.2-598s1c1
Sequence:CCGGGATGAAGAAGAGCGGAAACCTCTCGAGAGGTTTCCGCTCTTCTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031485.2-1573s1c1
Sequence:CCGGGCTTGGAAACTGAAGTCGAATCTCGAGATTCGACTTCAGTTTCCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031485.2-574s1c1
Sequence:CCGGGAAGAAGAGGAGGAAGATGAACTCGAGTTCATCTTCCTCCTCTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031485
VALIDATED
GRWD1 MISSION shRNA Lentiviral Transduction Particles
glutamate-rich WD repeat containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031485.2-495s1c1
Sequence:CCGGCCAGAGCAACAGACTGATGATCTCGAGATCATCAGTCTGTTGCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031485.2-510s1c1
Sequence:CCGGGATGATGCTTCTGATGCACAACTCGAGTTGTGCATCAGAAGCATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031485.2-1719s1c1
Sequence:CCGGCTCACCAAAGAACTCGGTTTACTCGAGTAAACCGAGTTCTTTGGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031485.2-517s1c1
Sequence:CCGGCTTCTGATGCACAATCTGCATCTCGAGATGCAGATTGTGCATCAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031485.2-583s1c1
Sequence:CCGGGAGGAAGATGAAGAGGATGAACTCGAGTTCATCCTCTTCATCTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031485.2-568s1c1
Sequence:CCGGGATGAAGAAGAAGAGGAGGAACTCGAGTTCCTCCTCTTCTTCTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_031485.2-598s1c1
Sequence:CCGGGATGAAGAAGAGCGGAAACCTCTCGAGAGGTTTCCGCTCTTCTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031485.2-1573s1c1
Sequence:CCGGGCTTGGAAACTGAAGTCGAATCTCGAGATTCGACTTCAGTTTCCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031485.2-574s1c1
Sequence:CCGGGAAGAAGAGGAGGAAGATGAACTCGAGTTCATCTTCCTCCTCTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)