EMAIL THIS PAGE TO A FRIEND

GRXCR2

glutaredoxin, cysteine rich 2

52 Gene Product Result for
UniProtKB ID: A6NFK2
Gene ID:
Mouse(332309) glutaredoxin, cysteine rich 2
Rat(681048) glutaredoxin, cysteine rich 2
domestic guinea pig(100733546) glutaredoxin, cysteine rich 2
naked mole-rat(101696647) glutaredoxin, cysteine rich 2
sheep(101111364) glutaredoxin, cysteine rich 2
chicken(771645) glutaredoxin, cysteine rich 2
cow(787763) glutaredoxin, cysteine rich 2
domestic cat(101082544) glutaredoxin, cysteine rich 2
dog(100686755) glutaredoxin, cysteine rich 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080516 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080516 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080516 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033426 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033426 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033426 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU173381 MISSION® esiRNA esiRNA targeting mouse Grxcr2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080516 Rosetta Predictions human pricing
XM_926586 Rosetta Predictions human pricing
XM_001060086 Rosetta Predictions rat pricing
NM_001033426 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080516 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315597 predicted 244
2 SASI_Hs02_00315598 predicted 364
3 SASI_Hs02_00315599 predicted 244
4 SASI_Hs02_00315600 predicted 242
5 SASI_Hs02_00315601 predicted 451
6 SASI_Hs02_00315602 predicted 450
7 SASI_Hs02_00315603 predicted 513
8 SASI_Hs02_00315604 predicted 248
9 SASI_Hs02_00315605 predicted 307
10 SASI_Hs02_00315606 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926586 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00250654 predicted 365
2 SASI_Hs01_00250655 predicted 460
3 SASI_Hs01_00250656 predicted 468
4 SASI_Hs01_00250657 predicted 365
5 SASI_Hs01_00250658 predicted 461
6 SASI_Hs01_00250659 predicted 357
7 SASI_Hs01_00250660 predicted 360
8 SASI_Hs01_00250661 predicted 463
9 SASI_Hs01_00250662 predicted 354
10 SASI_Hs01_00250663 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060086 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295341 predicted 935
2 SASI_Rn02_00295342 predicted 939
3 SASI_Rn02_00295343 predicted 787
4 SASI_Rn02_00295344 predicted 945
5 SASI_Rn02_00295345 predicted 798
6 SASI_Rn02_00295346 predicted 781
7 SASI_Rn02_00295347 predicted 844
8 SASI_Rn02_00295348 predicted 808
9 SASI_Rn02_00295349 predicted 864
10 SASI_Rn02_00295350 predicted 785
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033426 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288738 predicted 276
2 SASI_Mm01_00198588 predicted 375
3 SASI_Mm01_00198589 predicted 851
4 SASI_Mm01_00198591 predicted 850
5 SASI_Mm01_00198592 predicted 289
6 SASI_Mm01_00198593 predicted 284
7 SASI_Mm01_00198594 predicted 826
8 SASI_Mm01_00198595 predicted 778
9 SASI_Mm01_00198596 predicted 595
10 SASI_Mm01_00198597 predicted 779
11 SASI_Mm01_00198590 predicted 719
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080516
GRXCR2 MISSION shRNA Bacterial Glycerol Stock
glutaredoxin, cysteine rich 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080516.1-355s21c1
Sequence:CCGGTTTGGAAAGATAATCATCTACCTCGAGGTAGATGATTATCTTTCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080516.1-502s21c1
Sequence:CCGGGACCAGCACGATAGACCTTTGCTCGAGCAAAGGTCTATCGTGCTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080516.1-75s21c1
Sequence:CCGGCTCCTACAGCGGTCGAGTATTCTCGAGAATACTCGACCGCTGTAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080516.1-106s21c1
Sequence:CCGGTTTGAGGATGGGCAGGAATTACTCGAGTAATTCCTGCCCATCCTCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080516.1-257s21c1
Sequence:CCGGGTGTGTTTAGAGAGGGTAATGCTCGAGCATTACCCTCTCTAAACACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080516.1-297s21c1
Sequence:CCGGCCAGCCTCGGTTCAACGATTACTCGAGTAATCGTTGAACCGAGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080516.1-26s21c1
Sequence:CCGGATCAGAAGAGTGATGGCAAACCTCGAGGTTTGCCATCACTCTTCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080516.1-159s21c1
Sequence:CCGGTCTGCAAGAGTCTCTTGAAACCTCGAGGTTTCAAGAGACTCTTGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080516
GRXCR2 MISSION shRNA shRNA Plasmid DNA
glutaredoxin, cysteine rich 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080516.1-355s21c1
Sequence:CCGGTTTGGAAAGATAATCATCTACCTCGAGGTAGATGATTATCTTTCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080516.1-502s21c1
Sequence:CCGGGACCAGCACGATAGACCTTTGCTCGAGCAAAGGTCTATCGTGCTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080516.1-75s21c1
Sequence:CCGGCTCCTACAGCGGTCGAGTATTCTCGAGAATACTCGACCGCTGTAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080516.1-106s21c1
Sequence:CCGGTTTGAGGATGGGCAGGAATTACTCGAGTAATTCCTGCCCATCCTCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080516.1-257s21c1
Sequence:CCGGGTGTGTTTAGAGAGGGTAATGCTCGAGCATTACCCTCTCTAAACACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080516.1-297s21c1
Sequence:CCGGCCAGCCTCGGTTCAACGATTACTCGAGTAATCGTTGAACCGAGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080516.1-26s21c1
Sequence:CCGGATCAGAAGAGTGATGGCAAACCTCGAGGTTTGCCATCACTCTTCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080516.1-159s21c1
Sequence:CCGGTCTGCAAGAGTCTCTTGAAACCTCGAGGTTTCAAGAGACTCTTGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080516
GRXCR2 MISSION shRNA Lentiviral Transduction Particles
glutaredoxin, cysteine rich 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080516.1-355s21c1
Sequence:CCGGTTTGGAAAGATAATCATCTACCTCGAGGTAGATGATTATCTTTCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080516.1-502s21c1
Sequence:CCGGGACCAGCACGATAGACCTTTGCTCGAGCAAAGGTCTATCGTGCTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080516.1-75s21c1
Sequence:CCGGCTCCTACAGCGGTCGAGTATTCTCGAGAATACTCGACCGCTGTAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080516.1-106s21c1
Sequence:CCGGTTTGAGGATGGGCAGGAATTACTCGAGTAATTCCTGCCCATCCTCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080516.1-257s21c1
Sequence:CCGGGTGTGTTTAGAGAGGGTAATGCTCGAGCATTACCCTCTCTAAACACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080516.1-297s21c1
Sequence:CCGGCCAGCCTCGGTTCAACGATTACTCGAGTAATCGTTGAACCGAGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080516.1-26s21c1
Sequence:CCGGATCAGAAGAGTGATGGCAAACCTCGAGGTTTGCCATCACTCTTCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080516.1-159s21c1
Sequence:CCGGTCTGCAAGAGTCTCTTGAAACCTCGAGGTTTCAAGAGACTCTTGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033426
GRXCR2 MISSION shRNA Bacterial Glycerol Stock
glutaredoxin, cysteine rich 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033426.2-222s21c1
Sequence:CCGGGAACCAATGGATGGCGTTTATCTCGAGATAAACGCCATCCATTGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033426.2-781s21c1
Sequence:CCGGGCCTGCAACCTTGCCGAATTTCTCGAGAAATTCGGCAAGGTTGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033426.2-856s21c1
Sequence:CCGGACCACGTTACTCCTAATATAGCTCGAGCTATATTAGGAGTAACGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033426.2-378s21c1
Sequence:CCGGCATAAGCCTCCACCCATTATACTCGAGTATAATGGGTGGAGGCTTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033426.2-290s21c1
Sequence:CCGGTGCTCAGAGAATCAGCGTATTCTCGAGAATACGCTGATTCTCTGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033426
GRXCR2 MISSION shRNA shRNA Plasmid DNA
glutaredoxin, cysteine rich 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033426.2-222s21c1
Sequence:CCGGGAACCAATGGATGGCGTTTATCTCGAGATAAACGCCATCCATTGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033426.2-781s21c1
Sequence:CCGGGCCTGCAACCTTGCCGAATTTCTCGAGAAATTCGGCAAGGTTGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033426.2-856s21c1
Sequence:CCGGACCACGTTACTCCTAATATAGCTCGAGCTATATTAGGAGTAACGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033426.2-378s21c1
Sequence:CCGGCATAAGCCTCCACCCATTATACTCGAGTATAATGGGTGGAGGCTTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033426.2-290s21c1
Sequence:CCGGTGCTCAGAGAATCAGCGTATTCTCGAGAATACGCTGATTCTCTGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033426
GRXCR2 MISSION shRNA Lentiviral Transduction Particles
glutaredoxin, cysteine rich 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033426.2-222s21c1
Sequence:CCGGGAACCAATGGATGGCGTTTATCTCGAGATAAACGCCATCCATTGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033426.2-781s21c1
Sequence:CCGGGCCTGCAACCTTGCCGAATTTCTCGAGAAATTCGGCAAGGTTGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033426.2-856s21c1
Sequence:CCGGACCACGTTACTCCTAATATAGCTCGAGCTATATTAGGAGTAACGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033426.2-378s21c1
Sequence:CCGGCATAAGCCTCCACCCATTATACTCGAGTATAATGGGTGGAGGCTTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033426.2-290s21c1
Sequence:CCGGTGCTCAGAGAATCAGCGTATTCTCGAGAATACGCTGATTCTCTGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)