EMAIL THIS PAGE TO A FRIEND

GSAP

gamma-secretase activating protein

Synonyms: PION
UniProtKB ID: A4D1B5, A4D1B6, Q3MJC0, Q8ND73, Q9UMH3, Q9Y4L9
Gene ID:
Human(54103) Summary: Accumulation of neurotoxic amyloid-beta is a major hallmark of Alzheimer disease (AD; MIM 104300). Formation of amyloid-beta is catalyzed by gamma-secretase (see PSEN1; MIM 104311), a protease with numerous substrates. PION, or GSAP, selectively increases amyloid-beta production through a mechanism involving its interaction with both gamma-secretase and its substrate, the amyloid-beta precursor protein (APP; MIM 104760) C-terminal fragment (APP-CTF) (He et al., 2010 [PubMed 20811458]
Mouse(212167) gamma-secretase activating protein
Rat(311984) gamma-secretase activating protein
Zebrafish(100151358) gamma-secretase activating protein
domestic guinea pig(100725299) gamma-secretase activating protein
naked mole-rat(101697045) gamma-secretase activating protein
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017439 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017439 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017439 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175437 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175437 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175437 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017439 Rosetta Predictions human pricing
NM_001107845 Rosetta Predictions rat pricing
NM_175437 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239642 predicted 795
2 SASI_Hs01_00239644 predicted 1174
3 SASI_Hs02_00350028 predicted 432
4 SASI_Hs02_00350029 predicted 2375
5 SASI_Hs02_00350030 predicted 1791
6 SASI_Hs02_00350031 predicted 2350
7 SASI_Hs01_00239647 predicted 850
8 SASI_Hs02_00350032 predicted 517
9 SASI_Hs02_00350033 predicted 2603
10 SASI_Hs01_00239648 predicted 1343
11 SASI_Hs01_00239643 predicted 1420
12 SASI_Hs01_00239645 predicted 613
13 SASI_Hs01_00239646 predicted 1400
14 SASI_Hs01_00239649 predicted 1350
15 SASI_Hs01_00239650 predicted 773
16 SASI_Hs01_00239651 predicted 1340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107845 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232845 predicted 825
2 SASI_Rn02_00232846 predicted 1930
3 SASI_Rn02_00232847 predicted 442
4 SASI_Rn02_00232848 predicted 1357
5 SASI_Rn02_00232849 predicted 564
6 SASI_Rn02_00232850 predicted 595
7 SASI_Rn02_00232851 predicted 805
8 SASI_Rn02_00232852 predicted 1468
9 SASI_Rn02_00232853 predicted 2017
10 SASI_Rn02_00232854 predicted 1268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175437 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346317 predicted 1601
2 SASI_Mm01_00161456 predicted 735
3 SASI_Mm01_00161457 predicted 1443
4 SASI_Mm02_00346318 predicted 2070
5 SASI_Mm01_00161461 predicted 964
6 SASI_Mm02_00346319 predicted 2524
7 SASI_Mm01_00161463 predicted 1075
8 SASI_Mm02_00346320 predicted 1825
9 SASI_Mm02_00346321 predicted 201
10 SASI_Mm02_00346322 predicted 2311
11 SASI_Mm01_00161458 predicted 978
12 SASI_Mm01_00161459 predicted 982
13 SASI_Mm01_00161460 predicted 643
14 SASI_Mm01_00161462 predicted 209
15 SASI_Mm01_00161464 predicted 582
16 SASI_Mm01_00161465 predicted 860
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017439
VALIDATED
GSAP MISSION shRNA Bacterial Glycerol Stock
gamma-secretase activating protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017439.3-828s21c1
Sequence:CCGGTACCCTTGGACATATCATTAACTCGAGTTAATGATATGTCCAAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017439.3-644s21c1
Sequence:CCGGGGAAATAGAGTGGTGATTAAACTCGAGTTTAATCACCACTCTATTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_017439.3-1298s21c1
Sequence:CCGGCTGCTCAGCCAGTCGTCTTTACTCGAGTAAAGACGACTGGCTGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_017439.3-2899s21c1
Sequence:CCGGTGCTCTTCCTAGTAGCTTAATCTCGAGATTAAGCTACTAGGAAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017439.1-935s1c1
Sequence:CCGGGCTGTTTACTTACCTGGTCATCTCGAGATGACCAGGTAAGTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017439.1-1516s1c1
Sequence:CCGGCCACTATAACAACAGTGTGGTCTCGAGACCACACTGTTGTTATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_017439.1-1304s1c1
Sequence:CCGGGCTTCTTCATACTGGAGTGTACTCGAGTACACTCCAGTATGAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_017439.1-1229s1c1
Sequence:CCGGGCCCAGATTATTCAGTGGATTCTCGAGAATCCACTGAATAATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017439.1-1791s1c1
Sequence:CCGGGCACATTCATAGTAGAAGTATCTCGAGATACTTCTACTATGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017439
VALIDATED
GSAP MISSION shRNA shRNA Plasmid DNA
gamma-secretase activating protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017439.3-828s21c1
Sequence:CCGGTACCCTTGGACATATCATTAACTCGAGTTAATGATATGTCCAAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017439.3-644s21c1
Sequence:CCGGGGAAATAGAGTGGTGATTAAACTCGAGTTTAATCACCACTCTATTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_017439.3-1298s21c1
Sequence:CCGGCTGCTCAGCCAGTCGTCTTTACTCGAGTAAAGACGACTGGCTGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_017439.3-2899s21c1
Sequence:CCGGTGCTCTTCCTAGTAGCTTAATCTCGAGATTAAGCTACTAGGAAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017439.1-935s1c1
Sequence:CCGGGCTGTTTACTTACCTGGTCATCTCGAGATGACCAGGTAAGTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017439.1-1516s1c1
Sequence:CCGGCCACTATAACAACAGTGTGGTCTCGAGACCACACTGTTGTTATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_017439.1-1304s1c1
Sequence:CCGGGCTTCTTCATACTGGAGTGTACTCGAGTACACTCCAGTATGAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_017439.1-1229s1c1
Sequence:CCGGGCCCAGATTATTCAGTGGATTCTCGAGAATCCACTGAATAATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017439.1-1791s1c1
Sequence:CCGGGCACATTCATAGTAGAAGTATCTCGAGATACTTCTACTATGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017439
VALIDATED
GSAP MISSION shRNA Lentiviral Transduction Particles
gamma-secretase activating protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017439.3-828s21c1
Sequence:CCGGTACCCTTGGACATATCATTAACTCGAGTTAATGATATGTCCAAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017439.3-644s21c1
Sequence:CCGGGGAAATAGAGTGGTGATTAAACTCGAGTTTAATCACCACTCTATTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_017439.3-1298s21c1
Sequence:CCGGCTGCTCAGCCAGTCGTCTTTACTCGAGTAAAGACGACTGGCTGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_017439.3-2899s21c1
Sequence:CCGGTGCTCTTCCTAGTAGCTTAATCTCGAGATTAAGCTACTAGGAAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017439.1-935s1c1
Sequence:CCGGGCTGTTTACTTACCTGGTCATCTCGAGATGACCAGGTAAGTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017439.1-1516s1c1
Sequence:CCGGCCACTATAACAACAGTGTGGTCTCGAGACCACACTGTTGTTATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_017439.1-1304s1c1
Sequence:CCGGGCTTCTTCATACTGGAGTGTACTCGAGTACACTCCAGTATGAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_017439.1-1229s1c1
Sequence:CCGGGCCCAGATTATTCAGTGGATTCTCGAGAATCCACTGAATAATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017439.1-1791s1c1
Sequence:CCGGGCACATTCATAGTAGAAGTATCTCGAGATACTTCTACTATGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175437
GSAP MISSION shRNA Bacterial Glycerol Stock
gamma-secretase activating protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175437.2-3141s1c1
Sequence:CCGGGCTCAGATAGAGCCATATTTACTCGAGTAAATATGGCTCTATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175437.2-376s1c1
Sequence:CCGGGCTGCGAGTTTCATTCAGTATCTCGAGATACTGAATGAAACTCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175437.2-1005s1c1
Sequence:CCGGCCATAAAGGATACAGAAAGATCTCGAGATCTTTCTGTATCCTTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175437.2-567s1c1
Sequence:CCGGGCTACTGATCTCAGAAGAGAACTCGAGTTCTCTTCTGAGATCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175437.2-1315s1c1
Sequence:CCGGCCAGTCATACTTGTTGCGGTTCTCGAGAACCGCAACAAGTATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175437
GSAP MISSION shRNA shRNA Plasmid DNA
gamma-secretase activating protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175437.2-3141s1c1
Sequence:CCGGGCTCAGATAGAGCCATATTTACTCGAGTAAATATGGCTCTATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175437.2-376s1c1
Sequence:CCGGGCTGCGAGTTTCATTCAGTATCTCGAGATACTGAATGAAACTCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175437.2-1005s1c1
Sequence:CCGGCCATAAAGGATACAGAAAGATCTCGAGATCTTTCTGTATCCTTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175437.2-567s1c1
Sequence:CCGGGCTACTGATCTCAGAAGAGAACTCGAGTTCTCTTCTGAGATCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175437.2-1315s1c1
Sequence:CCGGCCAGTCATACTTGTTGCGGTTCTCGAGAACCGCAACAAGTATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175437
GSAP MISSION shRNA Lentiviral Transduction Particles
gamma-secretase activating protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175437.2-3141s1c1
Sequence:CCGGGCTCAGATAGAGCCATATTTACTCGAGTAAATATGGCTCTATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175437.2-376s1c1
Sequence:CCGGGCTGCGAGTTTCATTCAGTATCTCGAGATACTGAATGAAACTCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175437.2-1005s1c1
Sequence:CCGGCCATAAAGGATACAGAAAGATCTCGAGATCTTTCTGTATCCTTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175437.2-567s1c1
Sequence:CCGGGCTACTGATCTCAGAAGAGAACTCGAGTTCTCTTCTGAGATCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175437.2-1315s1c1
Sequence:CCGGCCAGTCATACTTGTTGCGGTTCTCGAGAACCGCAACAAGTATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks