EMAIL THIS PAGE TO A FRIEND

GSC2

goosecoid homeobox 2

Synonyms: GSCL
UniProtKB ID: O15499
Gene ID:
Human(2928) Summary: Goosecoidlike (GSCL), a homeodomain-containing gene, resides in the critical region for VCFS/DGS on 22q11. Velocardiofacial syndrome (VCFS) is a developmental disorder characterized by conotruncal heart defects, craniofacial anomalies, and learning disabilities. VCFS is phenotypically related to DiGeorge syndrome (DGS) and both syndromes are associated with hemizygous 22q11 deletions. Because many of the tissues and structures affected in VCFS/DGS derive from the pharyngeal arches of the developing embryo, it is believed that haploinsufficiency of a gene involved in embryonic development may be responsible for its etiology. The gene is expressed in a limited number of adult tissues, as well as in early human development. [provided by RefSeq, Jul 2008]
Mouse(195333) goosecoid homebox 2
Rat(363831) goosecoid homeobox 2
naked mole-rat(101709413) goosecoid homeobox 2
chicken(427702) goosecoid homeobox 2
cow(100298735) goosecoid homeobox 2
dog(608374) goosecoid homeobox 2
chicken(101667980) goosecoid homeobox 2
chicken(101750576) goosecoid homeobox 2
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005315 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005315 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005315 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_358939 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_358939 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_358939 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU162421 MISSION® esiRNA esiRNA targeting mouse Gsc2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005315 Rosetta Predictions human pricing
NM_001108846 Rosetta Predictions rat pricing
XM_001476809 Rosetta Predictions mouse pricing
XM_001480613 Rosetta Predictions mouse pricing
XM_001480751 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005315 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339382 predicted 531
2 SASI_Hs01_00214653 predicted 531
3 SASI_Hs01_00214656 predicted 497
4 SASI_Hs01_00214657 predicted 383
5 SASI_Hs01_00214658 predicted 557
6 SASI_Hs01_00214659 predicted 431
7 SASI_Hs01_00214660 predicted 440
8 SASI_Hs01_00214661 predicted 476
9 SASI_Hs02_00339383 predicted 487
10 SASI_Hs01_00214662 predicted 379
11 SASI_Hs01_00214654 predicted 578
12 SASI_Hs01_00214655 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108846 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242655 predicted 306
2 SASI_Rn02_00242656 predicted 711
3 SASI_Rn02_00242657 predicted 558
4 SASI_Rn02_00242658 predicted 825
5 SASI_Rn02_00242659 predicted 652
6 SASI_Rn02_00242660 predicted 673
7 SASI_Rn02_00242661 predicted 712
8 SASI_Rn02_00242662 predicted 624
9 SASI_Rn02_00242663 predicted 812
10 SASI_Rn02_00242664 predicted 754
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001476809 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00391502 predicted 421
2 SASI_Mm02_00391503 predicted 464
3 SASI_Mm02_00391504 predicted 472
4 SASI_Mm02_00391505 predicted 413
5 SASI_Mm02_00391506 predicted 465
6 SASI_Mm02_00391507 predicted 420
7 SASI_Mm02_00391508 predicted 493
8 SASI_Mm02_00391509 predicted 495
9 SASI_Mm02_00391510 predicted 481
10 SASI_Mm02_00391511 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480613 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00418774 predicted 420
2 SASI_Mm02_00418775 predicted 462
3 SASI_Mm02_00418776 predicted 476
4 SASI_Mm02_00418777 predicted 416
5 SASI_Mm02_00418778 predicted 466
6 SASI_Mm02_00418779 predicted 419
7 SASI_Mm02_00418780 predicted 500
8 SASI_Mm02_00418781 predicted 498
9 SASI_Mm02_00418782 predicted 485
10 SASI_Mm02_00418783 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480751 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00419532 predicted 420
2 SASI_Mm02_00419533 predicted 466
3 SASI_Mm02_00419534 predicted 473
4 SASI_Mm02_00419535 predicted 413
5 SASI_Mm02_00419536 predicted 459
6 SASI_Mm02_00419537 predicted 420
7 SASI_Mm02_00419538 predicted 493
8 SASI_Mm02_00419539 predicted 494
9 SASI_Mm02_00419540 predicted 479
10 SASI_Mm02_00419541 predicted 308
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005315
GSC2 MISSION shRNA Bacterial Glycerol Stock
goosecoid homeobox 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005315.1-443s1c1
Sequence:CCGGACCAGTATCCTGACGTGAGTACTCGAGTACTCACGTCAGGATACTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005315.1-387s1c1
Sequence:CCGGCCGCACCATCTTCAGCGAAGACTCGAGTCTTCGCTGAAGATGGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005315.1-301s1c1
Sequence:CCGGCCCTTGTCTCTGGGTGCGCCACTCGAGTGGCGCACCCAGAGACAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005315.1-62s1c1
Sequence:CCGGCCATCGAGCACATCCTCTCCACTCGAGTGGAGAGGATGTGCTCGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005315.1-435s1c1
Sequence:CCGGCGTGCAGAACCAGTATCCTGACTCGAGTCAGGATACTGGTTCTGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005315
GSC2 MISSION shRNA shRNA Plasmid DNA
goosecoid homeobox 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005315.1-443s1c1
Sequence:CCGGACCAGTATCCTGACGTGAGTACTCGAGTACTCACGTCAGGATACTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005315.1-387s1c1
Sequence:CCGGCCGCACCATCTTCAGCGAAGACTCGAGTCTTCGCTGAAGATGGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005315.1-301s1c1
Sequence:CCGGCCCTTGTCTCTGGGTGCGCCACTCGAGTGGCGCACCCAGAGACAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005315.1-62s1c1
Sequence:CCGGCCATCGAGCACATCCTCTCCACTCGAGTGGAGAGGATGTGCTCGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005315.1-435s1c1
Sequence:CCGGCGTGCAGAACCAGTATCCTGACTCGAGTCAGGATACTGGTTCTGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005315
GSC2 MISSION shRNA Lentiviral Transduction Particles
goosecoid homeobox 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005315.1-443s1c1
Sequence:CCGGACCAGTATCCTGACGTGAGTACTCGAGTACTCACGTCAGGATACTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005315.1-387s1c1
Sequence:CCGGCCGCACCATCTTCAGCGAAGACTCGAGTCTTCGCTGAAGATGGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005315.1-301s1c1
Sequence:CCGGCCCTTGTCTCTGGGTGCGCCACTCGAGTGGCGCACCCAGAGACAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005315.1-62s1c1
Sequence:CCGGCCATCGAGCACATCCTCTCCACTCGAGTGGAGAGGATGTGCTCGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005315.1-435s1c1
Sequence:CCGGCGTGCAGAACCAGTATCCTGACTCGAGTCAGGATACTGGTTCTGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_358939
GSC2 MISSION shRNA Bacterial Glycerol Stock
goosecoid homeobox 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358939.1-183s1c1
Sequence:CCGGCGCCTGCTGCTGCTGCTGCAACTCGAGTTGCAGCAGCAGCAGCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358939.1-414s1c1
Sequence:CCGGCGAGGCACTCTTCGTACAGAACTCGAGTTCTGTACGAAGAGTGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358939.1-138s1c1
Sequence:CCGGCGCCGAGCTAGACGAACCCGACTCGAGTCGGGTTCGTCTAGCTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358939.1-42s1c1
Sequence:CCGGGCGACCCTGCCCTTTCTCCATCTCGAGATGGAGAAAGGGCAGGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358939.1-378s1c1
Sequence:CCGGCCGTACCATCTTCAGCGAGGACTCGAGTCCTCGCTGAAGATGGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_358939
GSC2 MISSION shRNA shRNA Plasmid DNA
goosecoid homeobox 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358939.1-183s1c1
Sequence:CCGGCGCCTGCTGCTGCTGCTGCAACTCGAGTTGCAGCAGCAGCAGCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358939.1-414s1c1
Sequence:CCGGCGAGGCACTCTTCGTACAGAACTCGAGTTCTGTACGAAGAGTGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358939.1-138s1c1
Sequence:CCGGCGCCGAGCTAGACGAACCCGACTCGAGTCGGGTTCGTCTAGCTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358939.1-42s1c1
Sequence:CCGGGCGACCCTGCCCTTTCTCCATCTCGAGATGGAGAAAGGGCAGGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358939.1-378s1c1
Sequence:CCGGCCGTACCATCTTCAGCGAGGACTCGAGTCCTCGCTGAAGATGGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_358939
GSC2 MISSION shRNA Lentiviral Transduction Particles
goosecoid homeobox 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358939.1-183s1c1
Sequence:CCGGCGCCTGCTGCTGCTGCTGCAACTCGAGTTGCAGCAGCAGCAGCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358939.1-414s1c1
Sequence:CCGGCGAGGCACTCTTCGTACAGAACTCGAGTTCTGTACGAAGAGTGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358939.1-138s1c1
Sequence:CCGGCGCCGAGCTAGACGAACCCGACTCGAGTCGGGTTCGTCTAGCTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358939.1-42s1c1
Sequence:CCGGGCGACCCTGCCCTTTCTCCATCTCGAGATGGAGAAAGGGCAGGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358939.1-378s1c1
Sequence:CCGGCCGTACCATCTTCAGCGAGGACTCGAGTCCTCGCTGAAGATGGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks