EMAIL THIS PAGE TO A FRIEND

GSC

goosecoid homeobox

60 Gene Product Result for
UniProtKB ID: P56915, Q86YR1
Gene ID:
Human(145258) Summary: This gene encodes a member of the bicoid subfamily of the paired (PRD) homeobox family of proteins. The encoded protein acts as a transcription factor and may be autoregulatory. A similar protein in mice plays a role in craniofacial and rib cage development during embryogenesis. [provided by RefSeq, Jul 2008]
Mouse(14836) goosecoid homeobox
Rat(317715) goosecoid homeobox
Zebrafish(30212) goosecoid
fruit fly(33240) Goosecoid
cow(514862) goosecoid homeobox
dog(100683589) goosecoid homeobox
chicken(396273) goosecoid homeobox
domestic guinea pig(100726440) goosecoid homeobox
naked mole-rat(101720709) goosecoid homeobox
sheep(101119760) goosecoid homeobox
Domestic Rabbit(100101572) goosecoid homeobox
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010351 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010351 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010351 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173849 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173849 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173849 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU001791 MISSION® esiRNA esiRNA targeting mouse Gsc (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173849 Rosetta Predictions human pricing
XM_001067894 Rosetta Predictions rat pricing
XM_343101 Rosetta Predictions rat pricing
NM_010351 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173849 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010451 predicted 923
2 SASI_Hs01_00010452 predicted 938
3 SASI_Hs01_00010453 predicted 667
4 SASI_Hs01_00010454 predicted 653
5 SASI_Hs01_00010455 predicted 925
6 SASI_Hs01_00010456 predicted 778
7 SASI_Hs01_00010457 predicted 900
8 SASI_Hs01_00010458 predicted 891
9 SASI_Hs01_00010459 predicted 642
10 SASI_Hs01_00010460 predicted 937
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067894 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00322746 predicted 959
2 SASI_Rn02_00322747 predicted 304
3 SASI_Rn02_00322748 predicted 690
4 SASI_Rn02_00322749 predicted 1021
5 SASI_Rn02_00322750 predicted 448
6 SASI_Rn02_00322751 predicted 222
7 SASI_Rn02_00322752 predicted 226
8 SASI_Rn02_00322753 predicted 932
9 SASI_Rn02_00322754 predicted 849
10 SASI_Rn02_00322755 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343101 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395323 predicted 329
2 SASI_Rn02_00395324 predicted 303
3 SASI_Rn02_00395325 predicted 1023
4 SASI_Rn02_00395326 predicted 1109
5 SASI_Rn02_00395327 predicted 223
6 SASI_Rn02_00395328 predicted 231
7 SASI_Rn02_00395329 predicted 299
8 SASI_Rn02_00395330 predicted 336
9 SASI_Rn02_00395331 predicted 1042
10 SASI_Rn02_00395332 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010351 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062265 predicted 749
2 SASI_Mm01_00062266 predicted 932
3 SASI_Mm01_00062267 predicted 519
4 SASI_Mm01_00062268 predicted 801
5 SASI_Mm01_00062269 predicted 847
6 SASI_Mm01_00062270 predicted 776
7 SASI_Mm01_00062271 predicted 270
8 SASI_Mm01_00062272 predicted 806
9 SASI_Mm01_00062273 predicted 346
10 SASI_Mm02_00318371 predicted 863
11 SASI_Mm01_00062274 predicted 946
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010351
GSC MISSION shRNA Bacterial Glycerol Stock
goosecoid homeobox
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010351.1-1002s1c1
Sequence:CCGGCGAGGAGCTAGCTGTAAATAACTCGAGTTATTTACAGCTAGCTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010351.1-352s1c1
Sequence:CCGGCCTGGGCTACAACAGCTACTTCTCGAGAAGTAGCTGTTGTAGCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010351.1-814s1c1
Sequence:CCGGGTGGAACAAGACGTCCTCAAACTCGAGTTTGAGGACGTCTTGTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010351.1-658s1c1
Sequence:CCGGCCAGGAGACGAAGTACCCAGACTCGAGTCTGGGTACTTCGTCTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010351.1-517s1c1
Sequence:CCGGGCACCAGATGCTGCCCTACATCTCGAGATGTAGGGCAGCATCTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010351.1-743s21c1
Sequence:CCGGTTTAAGAACCGCCGAGCCAAGCTCGAGCTTGGCTCGGCGGTTCTTAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010351.1-621s21c1
Sequence:CCGGTCACCGATGAGCAGCTCGAAGCTCGAGCTTCGAGCTGCTCATCGGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010351.1-872s21c1
Sequence:CCGGGATTTGGACTCGGACAGCTGACTCGAGTCAGCTGTCCGAGTCCAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010351
GSC MISSION shRNA shRNA Plasmid DNA
goosecoid homeobox
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010351.1-1002s1c1
Sequence:CCGGCGAGGAGCTAGCTGTAAATAACTCGAGTTATTTACAGCTAGCTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010351.1-352s1c1
Sequence:CCGGCCTGGGCTACAACAGCTACTTCTCGAGAAGTAGCTGTTGTAGCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010351.1-814s1c1
Sequence:CCGGGTGGAACAAGACGTCCTCAAACTCGAGTTTGAGGACGTCTTGTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010351.1-658s1c1
Sequence:CCGGCCAGGAGACGAAGTACCCAGACTCGAGTCTGGGTACTTCGTCTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010351.1-517s1c1
Sequence:CCGGGCACCAGATGCTGCCCTACATCTCGAGATGTAGGGCAGCATCTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010351.1-743s21c1
Sequence:CCGGTTTAAGAACCGCCGAGCCAAGCTCGAGCTTGGCTCGGCGGTTCTTAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010351.1-621s21c1
Sequence:CCGGTCACCGATGAGCAGCTCGAAGCTCGAGCTTCGAGCTGCTCATCGGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010351.1-872s21c1
Sequence:CCGGGATTTGGACTCGGACAGCTGACTCGAGTCAGCTGTCCGAGTCCAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010351
GSC MISSION shRNA Lentiviral Transduction Particles
goosecoid homeobox
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010351.1-1002s1c1
Sequence:CCGGCGAGGAGCTAGCTGTAAATAACTCGAGTTATTTACAGCTAGCTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010351.1-352s1c1
Sequence:CCGGCCTGGGCTACAACAGCTACTTCTCGAGAAGTAGCTGTTGTAGCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010351.1-814s1c1
Sequence:CCGGGTGGAACAAGACGTCCTCAAACTCGAGTTTGAGGACGTCTTGTTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010351.1-658s1c1
Sequence:CCGGCCAGGAGACGAAGTACCCAGACTCGAGTCTGGGTACTTCGTCTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010351.1-517s1c1
Sequence:CCGGGCACCAGATGCTGCCCTACATCTCGAGATGTAGGGCAGCATCTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010351.1-743s21c1
Sequence:CCGGTTTAAGAACCGCCGAGCCAAGCTCGAGCTTGGCTCGGCGGTTCTTAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010351.1-621s21c1
Sequence:CCGGTCACCGATGAGCAGCTCGAAGCTCGAGCTTCGAGCTGCTCATCGGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010351.1-872s21c1
Sequence:CCGGGATTTGGACTCGGACAGCTGACTCGAGTCAGCTGTCCGAGTCCAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173849
GSC MISSION shRNA Bacterial Glycerol Stock
goosecoid homeobox
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173849.x-381s1c1
Sequence:CCGGCGGCTACAACAACTACTTCTACTCGAGTAGAAGTAGTTGTTGTAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173849.x-828s1c1
Sequence:CCGGGAACGCGGAGAAGTGGAACAACTCGAGTTGTTCCACTTCTCCGCGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003292    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173849.x-1036s1c1
Sequence:CCGGCGAGGAGCTGTAAATAGTGTACTCGAGTACACTATTTACAGCTCCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173849.x-867s1c1
Sequence:CCGGGTCACCGGAGAAGAGGGAAGACTCGAGTCTTCCCTCTTCTCCGGTGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173849.x-378s1c1
Sequence:CCGGCCTCGGCTACAACAACTACTTCTCGAGAAGTAGTTGTTGTAGCCGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173849.2-972s21c1
Sequence:CCGGCAGACAGACGATGCTACTTTCCTCGAGGAAAGTAGCATCGTCTGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173849.2-932s21c1
Sequence:CCGGACACTTGCCCGTATTACTTACCTCGAGGTAAGTAATACGGGCAAGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173849.2-678s21c1
Sequence:CCGGCCTCTTCCAGGAGACCAAGTACTCGAGTACTTGGTCTCCTGGAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173849.2-547s21c1
Sequence:CCGGCAGATGCTGCCCTACATGAACCTCGAGGTTCATGTAGGGCAGCATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173849
GSC MISSION shRNA shRNA Plasmid DNA
goosecoid homeobox
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173849.x-381s1c1
Sequence:CCGGCGGCTACAACAACTACTTCTACTCGAGTAGAAGTAGTTGTTGTAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173849.x-828s1c1
Sequence:CCGGGAACGCGGAGAAGTGGAACAACTCGAGTTGTTCCACTTCTCCGCGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003292    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173849.x-1036s1c1
Sequence:CCGGCGAGGAGCTGTAAATAGTGTACTCGAGTACACTATTTACAGCTCCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173849.x-867s1c1
Sequence:CCGGGTCACCGGAGAAGAGGGAAGACTCGAGTCTTCCCTCTTCTCCGGTGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173849.x-378s1c1
Sequence:CCGGCCTCGGCTACAACAACTACTTCTCGAGAAGTAGTTGTTGTAGCCGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173849.2-972s21c1
Sequence:CCGGCAGACAGACGATGCTACTTTCCTCGAGGAAAGTAGCATCGTCTGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173849.2-932s21c1
Sequence:CCGGACACTTGCCCGTATTACTTACCTCGAGGTAAGTAATACGGGCAAGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173849.2-678s21c1
Sequence:CCGGCCTCTTCCAGGAGACCAAGTACTCGAGTACTTGGTCTCCTGGAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173849.2-547s21c1
Sequence:CCGGCAGATGCTGCCCTACATGAACCTCGAGGTTCATGTAGGGCAGCATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173849
GSC MISSION shRNA Lentiviral Transduction Particles
goosecoid homeobox
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173849.x-381s1c1
Sequence:CCGGCGGCTACAACAACTACTTCTACTCGAGTAGAAGTAGTTGTTGTAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173849.x-828s1c1
Sequence:CCGGGAACGCGGAGAAGTGGAACAACTCGAGTTGTTCCACTTCTCCGCGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003292    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173849.x-1036s1c1
Sequence:CCGGCGAGGAGCTGTAAATAGTGTACTCGAGTACACTATTTACAGCTCCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173849.x-867s1c1
Sequence:CCGGGTCACCGGAGAAGAGGGAAGACTCGAGTCTTCCCTCTTCTCCGGTGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173849.x-378s1c1
Sequence:CCGGCCTCGGCTACAACAACTACTTCTCGAGAAGTAGTTGTTGTAGCCGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173849.2-972s21c1
Sequence:CCGGCAGACAGACGATGCTACTTTCCTCGAGGAAAGTAGCATCGTCTGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173849.2-932s21c1
Sequence:CCGGACACTTGCCCGTATTACTTACCTCGAGGTAAGTAATACGGGCAAGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173849.2-678s21c1
Sequence:CCGGCCTCTTCCAGGAGACCAAGTACTCGAGTACTTGGTCTCCTGGAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173849.2-547s21c1
Sequence:CCGGCAGATGCTGCCCTACATGAACCTCGAGGTTCATGTAGGGCAGCATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)