EMAIL THIS PAGE TO A FRIEND

GSDMB

gasdermin B

41 Gene Product Result for
Synonyms: GSDML PRO2521
UniProtKB ID: Q8TAX9, B4DKK7, Q7Z377, Q8WY76, Q9NX71, Q9P163
Gene ID:
Human(55876) Summary: This gene encodes a member of the gasdermin-domain containing protein family. Other gasdermin-family genes are implicated in the regulation of apoptosis in epithelial cells, and are linked to cancer. Multiple transcript variants encoding different isoforms have been found for this gene. Additional variants have been described, but they are candidates for nonsense-mediated mRNA decay (NMD) and are unlikely to be protein-coding. [provided by RefSeq, Sep 2009]
sheep(101105086) gasdermin B
Horse(100067983) gasdermin B
cow(509296) gasdermin B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018530 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018530 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018530 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU098001 MISSION® esiRNA esiRNA human GSDMB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042471 Rosetta Predictions human pricing
NM_018530 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042471 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309988 predicted 1248
2 SASI_Hs02_00309989 predicted 1270
3 SASI_Hs02_00309990 predicted 499
4 SASI_Hs02_00309991 predicted 506
5 SASI_Hs02_00309992 predicted 1316
6 SASI_Hs02_00309993 predicted 1257
7 SASI_Hs02_00309994 predicted 399
8 SASI_Hs02_00309995 predicted 334
9 SASI_Hs02_00309996 predicted 568
10 SASI_Hs02_00309997 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018530 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352093 predicted 1308
2 SASI_Hs01_00240936 predicted 1337
3 SASI_Hs02_00352094 predicted 591
4 SASI_Hs02_00352095 predicted 596
5 SASI_Hs02_00352096 predicted 1388
6 SASI_Hs02_00352097 predicted 1330
7 SASI_Hs02_00352098 predicted 495
8 SASI_Hs01_00240942 predicted 426
9 SASI_Hs02_00352099 predicted 654
10 SASI_Hs02_00352100 predicted 488
11 SASI_Hs01_00240937 predicted 821
12 SASI_Hs01_00240938 predicted 470
13 SASI_Hs01_00240939 predicted 894
14 SASI_Hs01_00240940 predicted 683
15 SASI_Hs01_00240941 predicted 783
16 SASI_Hs01_00240943 predicted 1042
17 SASI_Hs01_00240944 predicted 781
18 SASI_Hs01_00240945 predicted 610
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018530
GSDMB MISSION shRNA Bacterial Glycerol Stock
gasdermin B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018530.1-304s1c1
Sequence:CCGGGCCTTGTTGATGCTGATAGATCTCGAGATCTATCAGCATCAACAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018530.1-1346s1c1
Sequence:CCGGGCTGTATGTTGTTGTCTCTATCTCGAGATAGAGACAACAACATACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018530.1-663s1c1
Sequence:CCGGCGATCAATTAATACGAGAGAACTCGAGTTCTCTCGTATTAATTGATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018530.1-1017s1c1
Sequence:CCGGGAGGATATTCGGCAGGATCTACTCGAGTAGATCCTGCCGAATATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018530.1-301s1c1
Sequence:CCGGGAAGCCTTGTTGATGCTGATACTCGAGTATCAGCATCAACAAGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018530.1-1259s1c1
Sequence:CCGGGAAATCTGTCATGGAGCAGAACTCGAGTTCTGCTCCATGACAGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018530.1-502s1c1
Sequence:CCGGCGGGAGAGTTGATAGTGAGATCTCGAGATCTCACTATCAACTCTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018530
GSDMB MISSION shRNA shRNA Plasmid DNA
gasdermin B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018530.1-304s1c1
Sequence:CCGGGCCTTGTTGATGCTGATAGATCTCGAGATCTATCAGCATCAACAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018530.1-1346s1c1
Sequence:CCGGGCTGTATGTTGTTGTCTCTATCTCGAGATAGAGACAACAACATACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018530.1-663s1c1
Sequence:CCGGCGATCAATTAATACGAGAGAACTCGAGTTCTCTCGTATTAATTGATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018530.1-1017s1c1
Sequence:CCGGGAGGATATTCGGCAGGATCTACTCGAGTAGATCCTGCCGAATATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018530.1-301s1c1
Sequence:CCGGGAAGCCTTGTTGATGCTGATACTCGAGTATCAGCATCAACAAGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018530.1-1259s1c1
Sequence:CCGGGAAATCTGTCATGGAGCAGAACTCGAGTTCTGCTCCATGACAGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018530.1-502s1c1
Sequence:CCGGCGGGAGAGTTGATAGTGAGATCTCGAGATCTCACTATCAACTCTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018530
GSDMB MISSION shRNA Lentiviral Transduction Particles
gasdermin B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018530.1-304s1c1
Sequence:CCGGGCCTTGTTGATGCTGATAGATCTCGAGATCTATCAGCATCAACAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018530.1-1346s1c1
Sequence:CCGGGCTGTATGTTGTTGTCTCTATCTCGAGATAGAGACAACAACATACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018530.1-663s1c1
Sequence:CCGGCGATCAATTAATACGAGAGAACTCGAGTTCTCTCGTATTAATTGATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018530.1-1017s1c1
Sequence:CCGGGAGGATATTCGGCAGGATCTACTCGAGTAGATCCTGCCGAATATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018530.1-301s1c1
Sequence:CCGGGAAGCCTTGTTGATGCTGATACTCGAGTATCAGCATCAACAAGGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018530.1-1259s1c1
Sequence:CCGGGAAATCTGTCATGGAGCAGAACTCGAGTTCTGCTCCATGACAGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018530.1-502s1c1
Sequence:CCGGCGGGAGAGTTGATAGTGAGATCTCGAGATCTCACTATCAACTCTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)