EMAIL THIS PAGE TO A FRIEND

GSDMC

gasdermin C

Synonyms: MLZE
UniProtKB ID: Q9BYG8, Q5XKF3, Q6P494
Gene ID:
Mouse(83492) gasdermin C
Rat(299908) gasdermin C
dog(609825) gasdermin C
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031415 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031415 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031415 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031378 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031378 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031378 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012491 MISSION® esiRNA esiRNA targeting human GSDMC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031415 Rosetta Predictions human pricing
NM_001134495 Rosetta Predictions rat pricing
XM_216925 Rosetta Predictions rat pricing
NM_031378 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179145 predicted 1286
2 SASI_Hs01_00179146 predicted 2037
3 SASI_Hs01_00179147 predicted 1097
4 SASI_Hs02_00358799 predicted 1377
5 SASI_Hs01_00179149 predicted 1107
6 SASI_Hs01_00179150 predicted 1056
7 SASI_Hs01_00179151 predicted 2139
8 SASI_Hs01_00179152 predicted 1076
9 SASI_Hs01_00179154 predicted 1063
10 SASI_Hs02_00358800 predicted 1243
11 SASI_Hs01_00179148 predicted 2262
12 SASI_Hs01_00179153 predicted 1941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134495 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256439 predicted 635
2 SASI_Rn02_00256440 predicted 1086
3 SASI_Rn02_00256441 predicted 690
4 SASI_Rn02_00256442 predicted 627
5 SASI_Rn02_00256443 predicted 755
6 SASI_Rn02_00256444 predicted 427
7 SASI_Rn02_00256445 predicted 1256
8 SASI_Rn02_00256446 predicted 326
9 SASI_Rn02_00256447 predicted 647
10 SASI_Rn02_00256448 predicted 450
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216925 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376907 predicted 635
2 SASI_Rn02_00376908 predicted 1085
3 SASI_Rn02_00376909 predicted 696
4 SASI_Rn02_00376910 predicted 625
5 SASI_Rn02_00376911 predicted 755
6 SASI_Rn02_00376912 predicted 428
7 SASI_Rn02_00376913 predicted 1261
8 SASI_Rn02_00376914 predicted 334
9 SASI_Rn02_00376915 predicted 648
10 SASI_Rn02_00376916 predicted 451
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031378 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078154 predicted 1003
2 SASI_Mm01_00078155 predicted 349
3 SASI_Mm01_00078156 predicted 1306
4 SASI_Mm01_00078157 predicted 967
5 SASI_Mm01_00078158 predicted 785
6 SASI_Mm01_00078159 predicted 938
7 SASI_Mm02_00337121 predicted 273
8 SASI_Mm01_00078160 predicted 896
9 SASI_Mm01_00078161 predicted 983
10 SASI_Mm01_00078162 predicted 882
11 SASI_Mm01_00078153 predicted 822
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031415
GSDMC MISSION shRNA Bacterial Glycerol Stock
gasdermin C
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031415.1-1800s1c1
Sequence:CCGGCCCAGTAGGAAGAATAGAGGACTCGAGTCCTCTATTCTTCCTACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031415.1-1398s1c1
Sequence:CCGGGCTGTACGATAGCAGTAGTGTCTCGAGACACTACTGCTATCGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031415.1-979s1c1
Sequence:CCGGGCCACCAAATTACGTCAGTTTCTCGAGAAACTGACGTAATTTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031415.1-2017s1c1
Sequence:CCGGGCCATCCTAAAGAAACTTCAACTCGAGTTGAAGTTTCTTTAGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031415.1-2530s1c1
Sequence:CCGGGAGTAGAGACAGTAATGGGTACTCGAGTACCCATTACTGTCTCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031415.1-2190s1c1
Sequence:CCGGCCTGGAGCCAAACTTCAGATACTCGAGTATCTGAAGTTTGGCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031415
GSDMC MISSION shRNA shRNA Plasmid DNA
gasdermin C
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031415.1-1800s1c1
Sequence:CCGGCCCAGTAGGAAGAATAGAGGACTCGAGTCCTCTATTCTTCCTACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031415.1-1398s1c1
Sequence:CCGGGCTGTACGATAGCAGTAGTGTCTCGAGACACTACTGCTATCGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031415.1-979s1c1
Sequence:CCGGGCCACCAAATTACGTCAGTTTCTCGAGAAACTGACGTAATTTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031415.1-2017s1c1
Sequence:CCGGGCCATCCTAAAGAAACTTCAACTCGAGTTGAAGTTTCTTTAGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031415.1-2530s1c1
Sequence:CCGGGAGTAGAGACAGTAATGGGTACTCGAGTACCCATTACTGTCTCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031415.1-2190s1c1
Sequence:CCGGCCTGGAGCCAAACTTCAGATACTCGAGTATCTGAAGTTTGGCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031415
GSDMC MISSION shRNA Lentiviral Transduction Particles
gasdermin C
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031415.1-1800s1c1
Sequence:CCGGCCCAGTAGGAAGAATAGAGGACTCGAGTCCTCTATTCTTCCTACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031415.1-1398s1c1
Sequence:CCGGGCTGTACGATAGCAGTAGTGTCTCGAGACACTACTGCTATCGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031415.1-979s1c1
Sequence:CCGGGCCACCAAATTACGTCAGTTTCTCGAGAAACTGACGTAATTTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031415.1-2017s1c1
Sequence:CCGGGCCATCCTAAAGAAACTTCAACTCGAGTTGAAGTTTCTTTAGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031415.1-2530s1c1
Sequence:CCGGGAGTAGAGACAGTAATGGGTACTCGAGTACCCATTACTGTCTCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031415.1-2190s1c1
Sequence:CCGGCCTGGAGCCAAACTTCAGATACTCGAGTATCTGAAGTTTGGCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031378
VALIDATED
GSDMC MISSION shRNA Bacterial Glycerol Stock
gasdermin C
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031378.1-1204s1c1
Sequence:CCGGCCTTTCATGGATTAACCTAAACTCGAGTTTAGGTTAATCCATGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031378.1-347s1c1
Sequence:CCGGCATCTCTTGGAGCCCAATATTCTCGAGAATATTGGGCTCCAAGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031378.1-403s1c1
Sequence:CCGGCCTTAAACACACCATATCCCACTCGAGTGGGATATGGTGTGTTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031378.1-662s1c1
Sequence:CCGGGAAGGCACAAGCAATAGCAAACTCGAGTTTGCTATTGCTTGTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031378.1-475s1c1
Sequence:CCGGGTTTGTTAAGTCCTGTGGATACTCGAGTATCCACAGGACTTAACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031378.1-1599s1c1
Sequence:CCGGCCTGGATACATTTGAGATATTCTCGAGAATATCTCAAATGTATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190842    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031378.1-1591s1c1
Sequence:CCGGGCCTCAGTCCTGGATACATTTCTCGAGAAATGTATCCAGGACTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031378.1-753s1c1
Sequence:CCGGCAGATTCAATACCTATCCAAACTCGAGTTTGGATAGGTATTGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031378.3-613s21c1
Sequence:CCGGAGAGTAAGAGCATCCCAAATCCTCGAGGATTTGGGATGCTCTTACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031378.3-769s21c1
Sequence:CCGGGCACAAGCAATAGCAAATTTGCTCGAGCAAATTTGCTATTGCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031378.3-939s1c1
Sequence:CCGGCTCACTTCTGCTAACACTAAGCTCGAGCTTAGTGTTAGCAGAAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031378.3-905s21c1
Sequence:CCGGGCAATTGGTCATTGAGGATAACTCGAGTTATCCTCAATGACCAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031378
VALIDATED
GSDMC MISSION shRNA shRNA Plasmid DNA
gasdermin C
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031378.1-1204s1c1
Sequence:CCGGCCTTTCATGGATTAACCTAAACTCGAGTTTAGGTTAATCCATGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031378.1-347s1c1
Sequence:CCGGCATCTCTTGGAGCCCAATATTCTCGAGAATATTGGGCTCCAAGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031378.1-403s1c1
Sequence:CCGGCCTTAAACACACCATATCCCACTCGAGTGGGATATGGTGTGTTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031378.1-662s1c1
Sequence:CCGGGAAGGCACAAGCAATAGCAAACTCGAGTTTGCTATTGCTTGTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031378.1-475s1c1
Sequence:CCGGGTTTGTTAAGTCCTGTGGATACTCGAGTATCCACAGGACTTAACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031378.1-1599s1c1
Sequence:CCGGCCTGGATACATTTGAGATATTCTCGAGAATATCTCAAATGTATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190842    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031378.1-1591s1c1
Sequence:CCGGGCCTCAGTCCTGGATACATTTCTCGAGAAATGTATCCAGGACTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031378.1-753s1c1
Sequence:CCGGCAGATTCAATACCTATCCAAACTCGAGTTTGGATAGGTATTGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031378.3-613s21c1
Sequence:CCGGAGAGTAAGAGCATCCCAAATCCTCGAGGATTTGGGATGCTCTTACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031378.3-769s21c1
Sequence:CCGGGCACAAGCAATAGCAAATTTGCTCGAGCAAATTTGCTATTGCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031378.3-939s1c1
Sequence:CCGGCTCACTTCTGCTAACACTAAGCTCGAGCTTAGTGTTAGCAGAAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031378.3-905s21c1
Sequence:CCGGGCAATTGGTCATTGAGGATAACTCGAGTTATCCTCAATGACCAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031378
VALIDATED
GSDMC MISSION shRNA Lentiviral Transduction Particles
gasdermin C
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031378.1-1204s1c1
Sequence:CCGGCCTTTCATGGATTAACCTAAACTCGAGTTTAGGTTAATCCATGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031378.1-347s1c1
Sequence:CCGGCATCTCTTGGAGCCCAATATTCTCGAGAATATTGGGCTCCAAGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031378.1-403s1c1
Sequence:CCGGCCTTAAACACACCATATCCCACTCGAGTGGGATATGGTGTGTTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031378.1-662s1c1
Sequence:CCGGGAAGGCACAAGCAATAGCAAACTCGAGTTTGCTATTGCTTGTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031378.1-475s1c1
Sequence:CCGGGTTTGTTAAGTCCTGTGGATACTCGAGTATCCACAGGACTTAACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031378.1-1599s1c1
Sequence:CCGGCCTGGATACATTTGAGATATTCTCGAGAATATCTCAAATGTATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190842    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031378.1-1591s1c1
Sequence:CCGGGCCTCAGTCCTGGATACATTTCTCGAGAAATGTATCCAGGACTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_031378.1-753s1c1
Sequence:CCGGCAGATTCAATACCTATCCAAACTCGAGTTTGGATAGGTATTGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031378.3-613s21c1
Sequence:CCGGAGAGTAAGAGCATCCCAAATCCTCGAGGATTTGGGATGCTCTTACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031378.3-769s21c1
Sequence:CCGGGCACAAGCAATAGCAAATTTGCTCGAGCAAATTTGCTATTGCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031378.3-939s1c1
Sequence:CCGGCTCACTTCTGCTAACACTAAGCTCGAGCTTAGTGTTAGCAGAAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031378.3-905s21c1
Sequence:CCGGGCAATTGGTCATTGAGGATAACTCGAGTTATCCTCAATGACCAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks