EMAIL THIS PAGE TO A FRIEND

GSDMD

gasdermin D

47 Gene Product Result for
Synonyms: DF5L DFNA5L GSDMDC1
UniProtKB ID: P57764, D3DWJ9, Q96Q98
Gene ID:
Human(79792) Summary: Gasdermin D is a member of the gasdermin family. Members of this family appear to play a role in regulation of epithelial proliferation. Gasdermin D has been suggested to act as a tumor suppressor. Alternatively spliced transcript variants have been described. [provided by RefSeq, Oct 2009]
Mouse(69146) gasdermin D
Rat(315084) gasdermin D
sheep(101117254) gasdermin D
dog(609395) gasdermin D
cow(513939) gasdermin D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024736 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024736 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024736 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026960 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026960 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026960 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024736 Rosetta Predictions human pricing
NM_001130553 Rosetta Predictions rat pricing
NM_026960 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024736 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127295 predicted 1197
2 SASI_Hs01_00127297 predicted 796
3 SASI_Hs01_00127298 predicted 298
4 SASI_Hs01_00127299 predicted 1262
5 SASI_Hs01_00127300 predicted 288
6 SASI_Hs01_00127301 predicted 1230
7 SASI_Hs01_00127302 predicted 1223
8 SASI_Hs02_00357213 predicted 505
9 SASI_Hs01_00127303 predicted 1204
10 SASI_Hs01_00127304 predicted 479
11 SASI_Hs01_00127296 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130553 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255699 predicted 1463
2 SASI_Rn02_00255700 predicted 1018
3 SASI_Rn02_00255701 predicted 328
4 SASI_Rn02_00255702 predicted 692
5 SASI_Rn02_00255703 predicted 923
6 SASI_Rn02_00255704 predicted 362
7 SASI_Rn02_00255705 predicted 440
8 SASI_Rn02_00255706 predicted 754
9 SASI_Rn02_00255707 predicted 904
10 SASI_Rn02_00255708 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026960 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118432 predicted 809
2 SASI_Mm01_00118433 predicted 968
3 SASI_Mm01_00118434 predicted 315
4 SASI_Mm01_00118435 predicted 985
5 SASI_Mm02_00331278 predicted 1077
6 SASI_Mm01_00118437 predicted 813
7 SASI_Mm01_00118438 predicted 707
8 SASI_Mm01_00118439 predicted 426
9 SASI_Mm01_00118440 predicted 911
10 SASI_Mm01_00118441 predicted 304
11 SASI_Mm01_00118436 predicted 506
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024736
VALIDATED
GSDMD MISSION shRNA Bacterial Glycerol Stock
gasdermin D
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024736.6-999s21c1
Sequence:CCGGACTGAAGACTTCCAGGGCCTACTCGAGTAGGCCCTGGAAGTCTTCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024736.6-944s21c1
Sequence:CCGGGATGAGGTGCCTCCACAACTTCTCGAGAAGTTGTGGAGGCACCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024736.6-811s21c1
Sequence:CCGGTGGTTATTGACTCTGACTTGGCTCGAGCCAAGTCAGAGTCAATAACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024736.6-258s21c1
Sequence:CCGGTACTGCCTGGTGGTTAGGAAGCTCGAGCTTCCTAACCACCAGGCAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180013    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024736.4-2361s1c1
Sequence:CCGGCCTTCTCTTCCCGGATAAGAACTCGAGTTCTTATCCGGGAAGAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024736.4-717s1c1
Sequence:CCGGCAACCTGTCTATCAAGGACATCTCGAGATGTCCTTGATAGACAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024736.4-888s1c1
Sequence:CCGGCAGCACCTCAATGAATGTGTACTCGAGTACACATTCATTGAGGTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024736.4-711s1c1
Sequence:CCGGGTGTGTCAACCTGTCTATCAACTCGAGTTGATAGACAGGTTGACACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024736.4-900s1c1
Sequence:CCGGGAATGTGTACTCGCTGAGTGTCTCGAGACACTCAGCGAGTACACATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024736
VALIDATED
GSDMD MISSION shRNA shRNA Plasmid DNA
gasdermin D
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024736.6-999s21c1
Sequence:CCGGACTGAAGACTTCCAGGGCCTACTCGAGTAGGCCCTGGAAGTCTTCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024736.6-944s21c1
Sequence:CCGGGATGAGGTGCCTCCACAACTTCTCGAGAAGTTGTGGAGGCACCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024736.6-811s21c1
Sequence:CCGGTGGTTATTGACTCTGACTTGGCTCGAGCCAAGTCAGAGTCAATAACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024736.6-258s21c1
Sequence:CCGGTACTGCCTGGTGGTTAGGAAGCTCGAGCTTCCTAACCACCAGGCAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180013    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024736.4-2361s1c1
Sequence:CCGGCCTTCTCTTCCCGGATAAGAACTCGAGTTCTTATCCGGGAAGAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024736.4-717s1c1
Sequence:CCGGCAACCTGTCTATCAAGGACATCTCGAGATGTCCTTGATAGACAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024736.4-888s1c1
Sequence:CCGGCAGCACCTCAATGAATGTGTACTCGAGTACACATTCATTGAGGTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024736.4-711s1c1
Sequence:CCGGGTGTGTCAACCTGTCTATCAACTCGAGTTGATAGACAGGTTGACACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024736.4-900s1c1
Sequence:CCGGGAATGTGTACTCGCTGAGTGTCTCGAGACACTCAGCGAGTACACATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024736
VALIDATED
GSDMD MISSION shRNA Lentiviral Transduction Particles
gasdermin D
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024736.6-999s21c1
Sequence:CCGGACTGAAGACTTCCAGGGCCTACTCGAGTAGGCCCTGGAAGTCTTCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024736.6-944s21c1
Sequence:CCGGGATGAGGTGCCTCCACAACTTCTCGAGAAGTTGTGGAGGCACCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024736.6-811s21c1
Sequence:CCGGTGGTTATTGACTCTGACTTGGCTCGAGCCAAGTCAGAGTCAATAACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024736.6-258s21c1
Sequence:CCGGTACTGCCTGGTGGTTAGGAAGCTCGAGCTTCCTAACCACCAGGCAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180013    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024736.4-2361s1c1
Sequence:CCGGCCTTCTCTTCCCGGATAAGAACTCGAGTTCTTATCCGGGAAGAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024736.4-717s1c1
Sequence:CCGGCAACCTGTCTATCAAGGACATCTCGAGATGTCCTTGATAGACAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024736.4-888s1c1
Sequence:CCGGCAGCACCTCAATGAATGTGTACTCGAGTACACATTCATTGAGGTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024736.4-711s1c1
Sequence:CCGGGTGTGTCAACCTGTCTATCAACTCGAGTTGATAGACAGGTTGACACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024736.4-900s1c1
Sequence:CCGGGAATGTGTACTCGCTGAGTGTCTCGAGACACTCAGCGAGTACACATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026960
VALIDATED
GSDMD MISSION shRNA Bacterial Glycerol Stock
gasdermin D
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_026960.4-1494s1c1
Sequence:CCGGCCTAAGGCTGCAGGTAGAATCCTCGAGGATTCTACCTGCAGCCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026960.4-978s1c1
Sequence:CCGGGATTGATGAGGAGGAATTAATCTCGAGATTAATTCCTCCTCATCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026960.1-1579s1c1
Sequence:CCGGCCTATTGTCAAGTCTAGGCCACTCGAGTGGCCTAGACTTGACAATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026960.1-401s1c1
Sequence:CCGGGATGTCGTCGATGGGAACATTCTCGAGAATGTTCCCATCGACGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026960.1-1091s1c1
Sequence:CCGGCTGGTGAACATCGGAAAGATTCTCGAGAATCTTTCCGATGTTCACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_026960.1-808s1c1
Sequence:CCGGCCAACTGCTTATTGGCTCTAACTCGAGTTAGAGCCAATAAGCAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026960.1-325s1c1
Sequence:CCGGCCTGTCAATCAAGGACATCCTCTCGAGAGGATGTCCTTGATTGACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026960.1-716s1c1
Sequence:CCGGGCTTTATGCTTGAAGGGTGAACTCGAGTTCACCCTTCAAGCATAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026960.1-497s1c1
Sequence:CCGGGCCTCCATGAATGTGTGTATACTCGAGTATACACACATTCATGGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_026960.1-1573s1c1
Sequence:CCGGCCTGTTCCTATTGTCAAGTCTCTCGAGAGACTTGACAATAGGAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026960.1-839s1c1
Sequence:CCGGCTTCTCGTCTCAGATGAGAAACTCGAGTTTCTCATCTGAGACGAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026960
VALIDATED
GSDMD MISSION shRNA shRNA Plasmid DNA
gasdermin D
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_026960.4-1494s1c1
Sequence:CCGGCCTAAGGCTGCAGGTAGAATCCTCGAGGATTCTACCTGCAGCCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026960.4-978s1c1
Sequence:CCGGGATTGATGAGGAGGAATTAATCTCGAGATTAATTCCTCCTCATCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026960.1-1579s1c1
Sequence:CCGGCCTATTGTCAAGTCTAGGCCACTCGAGTGGCCTAGACTTGACAATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026960.1-401s1c1
Sequence:CCGGGATGTCGTCGATGGGAACATTCTCGAGAATGTTCCCATCGACGACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026960.1-1091s1c1
Sequence:CCGGCTGGTGAACATCGGAAAGATTCTCGAGAATCTTTCCGATGTTCACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_026960.1-808s1c1
Sequence:CCGGCCAACTGCTTATTGGCTCTAACTCGAGTTAGAGCCAATAAGCAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026960.1-325s1c1
Sequence:CCGGCCTGTCAATCAAGGACATCCTCTCGAGAGGATGTCCTTGATTGACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026960.1-716s1c1
Sequence:CCGGGCTTTATGCTTGAAGGGTGAACTCGAGTTCACCCTTCAAGCATAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026960.1-497s1c1
Sequence:CCGGGCCTCCATGAATGTGTGTATACTCGAGTATACACACATTCATGGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_026960.1-1573s1c1
Sequence:CCGGCCTGTTCCTATTGTCAAGTCTCTCGAGAGACTTGACAATAGGAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026960.1-839s1c1
Sequence:CCGGCTTCTCGTCTCAGATGAGAAACTCGAGTTTCTCATCTGAGACGAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026960
VALIDATED
GSDMD MISSION shRNA Lentiviral Transduction Particles
gasdermin D
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_026960.4-1494s1c1
Sequence:CCGGCCTAAGGCTGCAGGTAGAATCCTCGAGGATTCTACCTGCAGCCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026960.4-978s1c1
Sequence:CCGGGATTGATGAGGAGGAATTAATCTCGAGATTAATTCCTCCTCATCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026960.1-1579s1c1
Sequence:CCGGCCTATTGTCAAGTCTAGGCCACTCGAGTGGCCTAGACTTGACAATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026960.1-401s1c1
Sequence:CCGGGATGTCGTCGATGGGAACATTCTCGAGAATGTTCCCATCGACGACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026960.1-1091s1c1
Sequence:CCGGCTGGTGAACATCGGAAAGATTCTCGAGAATCTTTCCGATGTTCACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_026960.1-808s1c1
Sequence:CCGGCCAACTGCTTATTGGCTCTAACTCGAGTTAGAGCCAATAAGCAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026960.1-325s1c1
Sequence:CCGGCCTGTCAATCAAGGACATCCTCTCGAGAGGATGTCCTTGATTGACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026960.1-716s1c1
Sequence:CCGGGCTTTATGCTTGAAGGGTGAACTCGAGTTCACCCTTCAAGCATAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026960.1-497s1c1
Sequence:CCGGGCCTCCATGAATGTGTGTATACTCGAGTATACACACATTCATGGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_026960.1-1573s1c1
Sequence:CCGGCCTGTTCCTATTGTCAAGTCTCTCGAGAGACTTGACAATAGGAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026960.1-839s1c1
Sequence:CCGGCTTCTCGTCTCAGATGAGAAACTCGAGTTTCTCATCTGAGACGAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)