EMAIL THIS PAGE TO A FRIEND

GSE1

Gse1 coiled-coil protein

118 Gene Product Result for
Synonyms: KIAA0182
UniProtKB ID: Q14687, D3DUM4, Q8IY61, Q96GA4, Q9BW09
Gene ID:
Mouse(382034) genetic suppressor element 1
Rat(307913) Gse1 coiled-coil protein
Zebrafish(567033) Gse1 coiled-coil protein
domestic cat(101093230) Gse1 coiled-coil protein homolog (mouse)
domestic guinea pig(100724790) Gse1 coiled-coil protein
naked mole-rat(101700619) Gse1 coiled-coil protein
sheep(101102752) Gse1 coiled-coil protein homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA036365 Anti-GSE1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2101244 Anti-KIAA0182 antibody produced in rabbit affinity isolated antibody human, rat, horse, mouse, zebrafish, guinea pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198671 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198671 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198671 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014615 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014615 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014615 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014615 Rosetta Predictions human pricing
XM_001078877 Rosetta Predictions rat pricing
XM_226533 Rosetta Predictions rat pricing
NM_198671 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100591 predicted 3915
2 SASI_Hs01_00100592 predicted 4010
3 SASI_Hs01_00100593 predicted 2714
4 SASI_Hs01_00100594 predicted 3902
5 SASI_Hs01_00100595 predicted 2334
6 SASI_Hs01_00100596 predicted 3823
7 SASI_Hs01_00100597 predicted 3906
8 SASI_Hs01_00100598 predicted 2348
9 SASI_Hs01_00100599 predicted 3807
10 SASI_Hs01_00100600 predicted 2419
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078877 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00362320 predicted 2498
2 SASI_Rn02_00362321 predicted 3695
3 SASI_Rn02_00362322 predicted 2971
4 SASI_Rn02_00362323 predicted 4070
5 SASI_Rn02_00362324 predicted 2709
6 SASI_Rn02_00362325 predicted 2356
7 SASI_Rn02_00362326 predicted 3706
8 SASI_Rn02_00362327 predicted 3364
9 SASI_Rn02_00362328 predicted 2829
10 SASI_Rn02_00362329 predicted 2710
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226533 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383655 predicted 2873
2 SASI_Rn02_00383656 predicted 4067
3 SASI_Rn02_00383657 predicted 259
4 SASI_Rn02_00383658 predicted 4443
5 SASI_Rn02_00383659 predicted 3091
6 SASI_Rn02_00383660 predicted 2725
7 SASI_Rn02_00383661 predicted 273
8 SASI_Rn02_00383662 predicted 3738
9 SASI_Rn02_00383663 predicted 3207
10 SASI_Rn02_00383664 predicted 3085
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198671 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070305 predicted 2650
2 SASI_Mm01_00070306 predicted 3943
3 SASI_Mm01_00070307 predicted 1083
4 SASI_Mm01_00070308 predicted 2645
5 SASI_Mm01_00070309 predicted 2538
6 SASI_Mm02_00351148 predicted 3999
7 SASI_Mm01_00070310 predicted 2446
8 SASI_Mm01_00070312 predicted 3898
9 SASI_Mm02_00351149 predicted 671
10 SASI_Mm02_00351150 predicted 1085
11 SASI_Mm01_00070303 predicted 2446
12 SASI_Mm01_00070304 predicted 3980
13 SASI_Mm01_00070311 predicted 2949
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198671
GSE1 MISSION shRNA Bacterial Glycerol Stock
Gse1 coiled-coil protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198671.1-3636s1c1
Sequence:CCGGGCAAGGGATTGAGGCAATCTTCTCGAGAAGATTGCCTCAATCCCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198671.1-3333s1c1
Sequence:CCGGCGAAGAGTTTGCACATCAATTCTCGAGAATTGATGTGCAAACTCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198671.1-3637s1c1
Sequence:CCGGCAAGGGATTGAGGCAATCTTTCTCGAGAAAGATTGCCTCAATCCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198671.1-1074s21c1
Sequence:CCGGCAGGATGGATGACTCCTATTGCTCGAGCAATAGGAGTCATCCATCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217001    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198671.1-3936s1c1
Sequence:CCGGCTAGGCTGAACCTATAGTATACTCGAGTATACTATAGGTTCAGCCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198671.1-3449s21c1
Sequence:CCGGCGGCAATCCACTACAACATTCCTCGAGGAATGTTGTAGTGGATTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198671.1-3936s21c1
Sequence:CCGGCTAGGCTGAACCTATAGTATACTCGAGTATACTATAGGTTCAGCCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198671.1-3333s21c1
Sequence:CCGGCGAAGAGTTTGCACATCAATTCTCGAGAATTGATGTGCAAACTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198671.1-2142s21c1
Sequence:CCGGGGTGAAGGTGGAGCGAGTTTACTCGAGTAAACTCGCTCCACCTTCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198671
GSE1 MISSION shRNA shRNA Plasmid DNA
Gse1 coiled-coil protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198671.1-3636s1c1
Sequence:CCGGGCAAGGGATTGAGGCAATCTTCTCGAGAAGATTGCCTCAATCCCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198671.1-3333s1c1
Sequence:CCGGCGAAGAGTTTGCACATCAATTCTCGAGAATTGATGTGCAAACTCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198671.1-3637s1c1
Sequence:CCGGCAAGGGATTGAGGCAATCTTTCTCGAGAAAGATTGCCTCAATCCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198671.1-1074s21c1
Sequence:CCGGCAGGATGGATGACTCCTATTGCTCGAGCAATAGGAGTCATCCATCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217001    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198671.1-3936s1c1
Sequence:CCGGCTAGGCTGAACCTATAGTATACTCGAGTATACTATAGGTTCAGCCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198671.1-3449s21c1
Sequence:CCGGCGGCAATCCACTACAACATTCCTCGAGGAATGTTGTAGTGGATTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198671.1-3936s21c1
Sequence:CCGGCTAGGCTGAACCTATAGTATACTCGAGTATACTATAGGTTCAGCCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198671.1-3333s21c1
Sequence:CCGGCGAAGAGTTTGCACATCAATTCTCGAGAATTGATGTGCAAACTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198671.1-2142s21c1
Sequence:CCGGGGTGAAGGTGGAGCGAGTTTACTCGAGTAAACTCGCTCCACCTTCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198671
GSE1 MISSION shRNA Lentiviral Transduction Particles
Gse1 coiled-coil protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198671.1-3636s1c1
Sequence:CCGGGCAAGGGATTGAGGCAATCTTCTCGAGAAGATTGCCTCAATCCCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198671.1-3333s1c1
Sequence:CCGGCGAAGAGTTTGCACATCAATTCTCGAGAATTGATGTGCAAACTCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198671.1-3637s1c1
Sequence:CCGGCAAGGGATTGAGGCAATCTTTCTCGAGAAAGATTGCCTCAATCCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198671.1-1074s21c1
Sequence:CCGGCAGGATGGATGACTCCTATTGCTCGAGCAATAGGAGTCATCCATCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217001    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198671.1-3936s1c1
Sequence:CCGGCTAGGCTGAACCTATAGTATACTCGAGTATACTATAGGTTCAGCCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198671.1-3449s21c1
Sequence:CCGGCGGCAATCCACTACAACATTCCTCGAGGAATGTTGTAGTGGATTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198671.1-3936s21c1
Sequence:CCGGCTAGGCTGAACCTATAGTATACTCGAGTATACTATAGGTTCAGCCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198671.1-3333s21c1
Sequence:CCGGCGAAGAGTTTGCACATCAATTCTCGAGAATTGATGTGCAAACTCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198671.1-2142s21c1
Sequence:CCGGGGTGAAGGTGGAGCGAGTTTACTCGAGTAAACTCGCTCCACCTTCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014615
GSE1 MISSION shRNA Bacterial Glycerol Stock
Gse1 coiled-coil protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014615.1-3474s1c1
Sequence:CCGGCAGGAACACATAGAAGAGCAACTCGAGTTGCTCTTCTATGTGTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014615.1-7236s1c1
Sequence:CCGGGCAGTTTAGATGCTGTGAAATCTCGAGATTTCACAGCATCTAAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014615.1-3465s1c1
Sequence:CCGGGAAGCTTACCAGGAACACATACTCGAGTATGTGTTCCTGGTAAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014615.1-2633s1c1
Sequence:CCGGGATGAACAACAGTCCCAACTTCTCGAGAAGTTGGGACTGTTGTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127711    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014615.1-5534s1c1
Sequence:CCGGGCCAGTATTATCAGCAGTCAACTCGAGTTGACTGCTGATAATACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014615.1-2703s1c1
Sequence:CCGGGCTGAGAAGAGGAAAGACAAACTCGAGTTTGTCTTTCCTCTTCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014615.2-3885s21c1
Sequence:CCGGGAACTCACCTTGACGTCAATGCTCGAGCATTGACGTCAAGGTGAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014615.2-3030s21c1
Sequence:CCGGCTGAGCATGCTTCACTATATCCTCGAGGATATAGTGAAGCATGCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014615.2-2343s21c1
Sequence:CCGGTACGACCTCGATGACTCTTACCTCGAGGTAAGAGTCATCGAGGTCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014615.2-3715s21c1
Sequence:CCGGGATATCCCAGGTGACGGTTTCCTCGAGGAAACCGTCACCTGGGATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014615
GSE1 MISSION shRNA shRNA Plasmid DNA
Gse1 coiled-coil protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014615.1-3474s1c1
Sequence:CCGGCAGGAACACATAGAAGAGCAACTCGAGTTGCTCTTCTATGTGTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014615.1-7236s1c1
Sequence:CCGGGCAGTTTAGATGCTGTGAAATCTCGAGATTTCACAGCATCTAAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014615.1-3465s1c1
Sequence:CCGGGAAGCTTACCAGGAACACATACTCGAGTATGTGTTCCTGGTAAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014615.1-2633s1c1
Sequence:CCGGGATGAACAACAGTCCCAACTTCTCGAGAAGTTGGGACTGTTGTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127711    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014615.1-5534s1c1
Sequence:CCGGGCCAGTATTATCAGCAGTCAACTCGAGTTGACTGCTGATAATACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014615.1-2703s1c1
Sequence:CCGGGCTGAGAAGAGGAAAGACAAACTCGAGTTTGTCTTTCCTCTTCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014615.2-3885s21c1
Sequence:CCGGGAACTCACCTTGACGTCAATGCTCGAGCATTGACGTCAAGGTGAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014615.2-3030s21c1
Sequence:CCGGCTGAGCATGCTTCACTATATCCTCGAGGATATAGTGAAGCATGCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014615.2-2343s21c1
Sequence:CCGGTACGACCTCGATGACTCTTACCTCGAGGTAAGAGTCATCGAGGTCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014615.2-3715s21c1
Sequence:CCGGGATATCCCAGGTGACGGTTTCCTCGAGGAAACCGTCACCTGGGATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014615
GSE1 MISSION shRNA Lentiviral Transduction Particles
Gse1 coiled-coil protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014615.1-3474s1c1
Sequence:CCGGCAGGAACACATAGAAGAGCAACTCGAGTTGCTCTTCTATGTGTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014615.1-7236s1c1
Sequence:CCGGGCAGTTTAGATGCTGTGAAATCTCGAGATTTCACAGCATCTAAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014615.1-3465s1c1
Sequence:CCGGGAAGCTTACCAGGAACACATACTCGAGTATGTGTTCCTGGTAAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014615.1-2633s1c1
Sequence:CCGGGATGAACAACAGTCCCAACTTCTCGAGAAGTTGGGACTGTTGTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127711    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014615.1-5534s1c1
Sequence:CCGGGCCAGTATTATCAGCAGTCAACTCGAGTTGACTGCTGATAATACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014615.1-2703s1c1
Sequence:CCGGGCTGAGAAGAGGAAAGACAAACTCGAGTTTGTCTTTCCTCTTCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014615.2-3885s21c1
Sequence:CCGGGAACTCACCTTGACGTCAATGCTCGAGCATTGACGTCAAGGTGAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014615.2-3030s21c1
Sequence:CCGGCTGAGCATGCTTCACTATATCCTCGAGGATATAGTGAAGCATGCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014615.2-2343s21c1
Sequence:CCGGTACGACCTCGATGACTCTTACCTCGAGGTAAGAGTCATCGAGGTCGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014615.2-3715s21c1
Sequence:CCGGGATATCCCAGGTGACGGTTTCCTCGAGGAAACCGTCACCTGGGATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)