EMAIL THIS PAGE TO A FRIEND

GSG1

germ cell associated 1

130 Gene Product Result for
Gene ID:
Mouse(14840) germ cell-specific gene 1
Rat(312793) germ cell associated 1
sheep(101109690) germ cell associated 1
domestic guinea pig(100730921) germ cell associated 1
naked mole-rat(101724526) germ cell associated 1
chicken(769937) germ cell associated 1
Horse(100063635) germ cell associated 1
cow(530502) germ cell associated 1
domestic cat(101093869) germ cell associated 1
dog(486677) germ cell associated 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031289 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031289 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031289 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010352 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010352 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010352 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080554 Rosetta Predictions human pricing
NM_001080555 Rosetta Predictions human pricing
NM_031289 Rosetta Predictions human pricing
NM_153823 Rosetta Predictions human pricing
NM_001013166 Rosetta Predictions rat pricing
NM_001080552 Rosetta Predictions mouse pricing
NM_001080553 Rosetta Predictions mouse pricing
NM_010352 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080554 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315900 predicted 1020
2 SASI_Hs02_00315901 predicted 1229
3 SASI_Hs02_00315902 predicted 1005
4 SASI_Hs02_00315903 predicted 1124
5 SASI_Hs02_00315904 predicted 994
6 SASI_Hs02_00315905 predicted 1265
7 SASI_Hs02_00315906 predicted 1334
8 SASI_Hs02_00315907 predicted 1154
9 SASI_Hs02_00315908 predicted 1365
10 SASI_Hs02_00315909 predicted 1335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080555 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315910 predicted 891
2 SASI_Hs02_00315911 predicted 1106
3 SASI_Hs02_00315912 predicted 881
4 SASI_Hs02_00315913 predicted 1005
5 SASI_Hs02_00315914 predicted 871
6 SASI_Hs02_00315915 predicted 1144
7 SASI_Hs02_00315916 predicted 1212
8 SASI_Hs02_00315917 predicted 1028
9 SASI_Hs02_00315918 predicted 1241
10 SASI_Hs02_00315919 predicted 1213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031289 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118268 predicted 902
2 SASI_Hs01_00118271 predicted 1119
3 SASI_Hs01_00118272 predicted 890
4 SASI_Hs01_00118274 predicted 1007
5 SASI_Hs01_00118275 predicted 881
6 SASI_Hs02_00358718 predicted 1150
7 SASI_Hs02_00358719 predicted 1224
8 SASI_Hs01_00118276 predicted 1040
9 SASI_Hs02_00358720 predicted 1256
10 SASI_Hs02_00358721 predicted 1221
11 SASI_Hs01_00118269 predicted 1029
12 SASI_Hs01_00118270 predicted 876
13 SASI_Hs01_00118273 predicted 880
14 SASI_Hs01_00118277 predicted 1098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153823 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055052 predicted 784
2 SASI_Hs01_00055055 predicted 999
3 SASI_Hs01_00055056 predicted 765
4 SASI_Hs01_00055058 predicted 884
5 SASI_Hs01_00055059 predicted 759
6 SASI_Hs02_00367500 predicted 1027
7 SASI_Hs02_00367501 predicted 1100
8 SASI_Hs01_00055060 predicted 915
9 SASI_Hs02_00367502 predicted 1131
10 SASI_Hs02_00367503 predicted 1096
11 SASI_Hs01_00055053 predicted 830
12 SASI_Hs01_00055054 predicted 671
13 SASI_Hs01_00055057 predicted 675
14 SASI_Hs01_00055061 predicted 904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013166 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082404 predicted 503
2 SASI_Rn01_00082405 predicted 694
3 SASI_Rn01_00082406 predicted 700
4 SASI_Rn01_00082407 predicted 492
5 SASI_Rn01_00082408 predicted 330
6 SASI_Rn01_00082409 predicted 952
7 SASI_Rn01_00082411 predicted 1072
8 SASI_Rn01_00082413 predicted 838
9 SASI_Rn02_00200908 predicted 709
10 SASI_Rn02_00200909 predicted 1007
11 SASI_Rn01_00082410 predicted 1077
12 SASI_Rn01_00082412 predicted 557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080552 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293493 predicted 335
2 SASI_Mm02_00293494 predicted 701
3 SASI_Mm02_00293495 predicted 776
4 SASI_Mm02_00293496 predicted 409
5 SASI_Mm02_00293497 predicted 366
6 SASI_Mm02_00293498 predicted 897
7 SASI_Mm02_00293499 predicted 761
8 SASI_Mm02_00293500 predicted 576
9 SASI_Mm02_00293501 predicted 422
10 SASI_Mm02_00293502 predicted 701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080553 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293503 predicted 479
2 SASI_Mm02_00293504 predicted 856
3 SASI_Mm02_00293505 predicted 933
4 SASI_Mm02_00293506 predicted 563
5 SASI_Mm02_00293507 predicted 525
6 SASI_Mm02_00293508 predicted 1045
7 SASI_Mm02_00293509 predicted 915
8 SASI_Mm02_00293510 predicted 734
9 SASI_Mm02_00293511 predicted 578
10 SASI_Mm02_00293512 predicted 856
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010352 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088383 predicted 542
2 SASI_Mm01_00088384 predicted 914
3 SASI_Mm01_00088385 predicted 995
4 SASI_Mm01_00088386 predicted 631
5 SASI_Mm01_00088388 predicted 587
6 SASI_Mm01_00088389 predicted 1103
7 SASI_Mm01_00088387 predicted 981
8 SASI_Mm01_00088391 predicted 789
9 SASI_Mm01_00088392 predicted 635
10 SASI_Mm02_00318372 predicted 909
11 SASI_Mm01_00088390 predicted 299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031289
GSG1 MISSION shRNA Bacterial Glycerol Stock
germ cell associated 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031289.2-1123s21c1
Sequence:CCGGCAGCTACCACCAGTATCATAACTCGAGTTATGATACTGGTGGTAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031289.2-1311s21c1
Sequence:CCGGCTTACACGTCTGCTGATTATCCTCGAGGATAATCAGCAGACGTGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031289.2-497s21c1
Sequence:CCGGAGAGGTGCCGAAGTTTCATTGCTCGAGCAATGAAACTTCGGCACCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031289.1-208s1c1
Sequence:CCGGCAGCATGCTATCACTCAGCTTCTCGAGAAGCTGAGTGATAGCATGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031289.1-815s1c1
Sequence:CCGGCCACATGATGTATTCACAAGTCTCGAGACTTGTGAATACATCATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031289.1-872s1c1
Sequence:CCGGGAGACCACATGTTTGGAATTACTCGAGTAATTCCAAACATGTGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031289.1-708s1c1
Sequence:CCGGCTGCTACTAACAGACTTGCTACTCGAGTAGCAAGTCTGTTAGTAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031289.1-683s1c1
Sequence:CCGGCGGACTTCAATTCATCAGCTTCTCGAGAAGCTGATGAATTGAAGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031289.1-669s1c1
Sequence:CCGGCAGATCACCTACATCGGACTTCTCGAGAAGTCCGATGTAGGTGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031289.1-981s1c1
Sequence:CCGGCTGGAGTTCAAGTGCAAGCATCTCGAGATGCTTGCACTTGAACTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031289
GSG1 MISSION shRNA shRNA Plasmid DNA
germ cell associated 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031289.2-1123s21c1
Sequence:CCGGCAGCTACCACCAGTATCATAACTCGAGTTATGATACTGGTGGTAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031289.2-1311s21c1
Sequence:CCGGCTTACACGTCTGCTGATTATCCTCGAGGATAATCAGCAGACGTGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031289.2-497s21c1
Sequence:CCGGAGAGGTGCCGAAGTTTCATTGCTCGAGCAATGAAACTTCGGCACCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031289.1-208s1c1
Sequence:CCGGCAGCATGCTATCACTCAGCTTCTCGAGAAGCTGAGTGATAGCATGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031289.1-815s1c1
Sequence:CCGGCCACATGATGTATTCACAAGTCTCGAGACTTGTGAATACATCATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031289.1-872s1c1
Sequence:CCGGGAGACCACATGTTTGGAATTACTCGAGTAATTCCAAACATGTGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031289.1-708s1c1
Sequence:CCGGCTGCTACTAACAGACTTGCTACTCGAGTAGCAAGTCTGTTAGTAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031289.1-683s1c1
Sequence:CCGGCGGACTTCAATTCATCAGCTTCTCGAGAAGCTGATGAATTGAAGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031289.1-669s1c1
Sequence:CCGGCAGATCACCTACATCGGACTTCTCGAGAAGTCCGATGTAGGTGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031289.1-981s1c1
Sequence:CCGGCTGGAGTTCAAGTGCAAGCATCTCGAGATGCTTGCACTTGAACTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031289
GSG1 MISSION shRNA Lentiviral Transduction Particles
germ cell associated 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031289.2-1123s21c1
Sequence:CCGGCAGCTACCACCAGTATCATAACTCGAGTTATGATACTGGTGGTAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031289.2-1311s21c1
Sequence:CCGGCTTACACGTCTGCTGATTATCCTCGAGGATAATCAGCAGACGTGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031289.2-497s21c1
Sequence:CCGGAGAGGTGCCGAAGTTTCATTGCTCGAGCAATGAAACTTCGGCACCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031289.1-208s1c1
Sequence:CCGGCAGCATGCTATCACTCAGCTTCTCGAGAAGCTGAGTGATAGCATGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031289.1-815s1c1
Sequence:CCGGCCACATGATGTATTCACAAGTCTCGAGACTTGTGAATACATCATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031289.1-872s1c1
Sequence:CCGGGAGACCACATGTTTGGAATTACTCGAGTAATTCCAAACATGTGGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031289.1-708s1c1
Sequence:CCGGCTGCTACTAACAGACTTGCTACTCGAGTAGCAAGTCTGTTAGTAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031289.1-683s1c1
Sequence:CCGGCGGACTTCAATTCATCAGCTTCTCGAGAAGCTGATGAATTGAAGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031289.1-669s1c1
Sequence:CCGGCAGATCACCTACATCGGACTTCTCGAGAAGTCCGATGTAGGTGATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031289.1-981s1c1
Sequence:CCGGCTGGAGTTCAAGTGCAAGCATCTCGAGATGCTTGCACTTGAACTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010352
GSG1 MISSION shRNA Bacterial Glycerol Stock
germ cell associated 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010352.1-861s1c1
Sequence:CCGGGAGACCACACTCTTGGAATTACTCGAGTAATTCCAAGAGTGTGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175281    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010352.1-1160s1c1
Sequence:CCGGCAGGACAAAGAATTTCAACAACTCGAGTTGTTGAAATTCTTTGTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010352.1-1121s1c1
Sequence:CCGGCGCTCTGTCTCTGAAGCTATTCTCGAGAATAGCTTCAGAGACAGAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010352.1-477s1c1
Sequence:CCGGCGTTTCATTGAACTCACACCACTCGAGTGGTGTGAGTTCAATGAAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010352.1-179s1c1
Sequence:CCGGCTTCATTTCTGCCATCCTCAACTCGAGTTGAGGATGGCAGAAATGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010352
GSG1 MISSION shRNA shRNA Plasmid DNA
germ cell associated 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010352.1-861s1c1
Sequence:CCGGGAGACCACACTCTTGGAATTACTCGAGTAATTCCAAGAGTGTGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175281    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010352.1-1160s1c1
Sequence:CCGGCAGGACAAAGAATTTCAACAACTCGAGTTGTTGAAATTCTTTGTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010352.1-1121s1c1
Sequence:CCGGCGCTCTGTCTCTGAAGCTATTCTCGAGAATAGCTTCAGAGACAGAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010352.1-477s1c1
Sequence:CCGGCGTTTCATTGAACTCACACCACTCGAGTGGTGTGAGTTCAATGAAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010352.1-179s1c1
Sequence:CCGGCTTCATTTCTGCCATCCTCAACTCGAGTTGAGGATGGCAGAAATGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010352
GSG1 MISSION shRNA Lentiviral Transduction Particles
germ cell associated 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010352.1-861s1c1
Sequence:CCGGGAGACCACACTCTTGGAATTACTCGAGTAATTCCAAGAGTGTGGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175281    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010352.1-1160s1c1
Sequence:CCGGCAGGACAAAGAATTTCAACAACTCGAGTTGTTGAAATTCTTTGTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010352.1-1121s1c1
Sequence:CCGGCGCTCTGTCTCTGAAGCTATTCTCGAGAATAGCTTCAGAGACAGAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010352.1-477s1c1
Sequence:CCGGCGTTTCATTGAACTCACACCACTCGAGTGGTGTGAGTTCAATGAAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010352.1-179s1c1
Sequence:CCGGCTTCATTTCTGCCATCCTCAACTCGAGTTGAGGATGGCAGAAATGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)