EMAIL THIS PAGE TO A FRIEND

GSG1L

GSG1-like

73 Gene Product Result for
Synonyms: PRO19651
UniProtKB ID: Q6UXU4, Q7Z6F8, Q8TB81
Gene ID:
Mouse(269994) GSG1-like
Rat(499263) GSG1-like
Zebrafish(664746) gsg1-like
cow(511049) GSG1-like
dog(607985) GSG1-like
chicken(768455) germ cell-specific gene 1-like protein-like
chicken(426763) GSG1-like
sheep(101120720) GSG1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001101488 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001101488 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001101488 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001109763 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001109763 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001109763 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001109763 Rosetta Predictions human pricing
NM_144675 Rosetta Predictions human pricing
XM_574558 Rosetta Predictions rat pricing
NM_001101488 Rosetta Predictions mouse pricing
XM_194378 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109763 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324743 predicted 813
2 SASI_Hs02_00324744 predicted 588
3 SASI_Hs02_00324745 predicted 826
4 SASI_Hs02_00324746 predicted 123
5 SASI_Hs02_00324747 predicted 803
6 SASI_Hs02_00324748 predicted 719
7 SASI_Hs02_00324749 predicted 812
8 SASI_Hs02_00324750 predicted 645
9 SASI_Hs02_00324751 predicted 1169
10 SASI_Hs02_00324752 predicted 1295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088153 predicted 433
2 SASI_Hs01_00088148 predicted 200
3 SASI_Hs01_00088149 predicted 439
4 SASI_Hs01_00088150 predicted 422
5 SASI_Hs01_00088151 predicted 332
6 SASI_Hs01_00088152 predicted 423
7 SASI_Hs01_00088154 predicted 266
8 SASI_Hs02_00364573 predicted 910
9 SASI_Hs02_00364574 predicted 183
10 SASI_Hs01_00088157 predicted 254
11 SASI_Hs01_00088155 predicted 793
12 SASI_Hs01_00088156 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574558 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402182 predicted 820
2 SASI_Rn02_00402183 predicted 883
3 SASI_Rn02_00402184 predicted 464
4 SASI_Rn02_00402185 predicted 815
5 SASI_Rn02_00402186 predicted 250
6 SASI_Rn02_00402187 predicted 894
7 SASI_Rn02_00402188 predicted 784
8 SASI_Rn02_00402189 predicted 686
9 SASI_Rn02_00402190 predicted 499
10 SASI_Rn02_00402191 predicted 823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101488 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302497 predicted 1664
2 SASI_Mm02_00302498 predicted 897
3 SASI_Mm02_00302499 predicted 1449
4 SASI_Mm02_00302500 predicted 1463
5 SASI_Mm02_00302501 predicted 921
6 SASI_Mm02_00302502 predicted 1629
7 SASI_Mm02_00302503 predicted 272
8 SASI_Mm02_00302504 predicted 926
9 SASI_Mm02_00302505 predicted 494
10 SASI_Mm02_00302506 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_194378 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00258669 predicted 1675
2 SASI_Mm01_00258670 predicted 836
3 SASI_Mm01_00258671 predicted 895
4 SASI_Mm01_00258672 predicted 1461
5 SASI_Mm01_00258673 predicted 929
6 SASI_Mm01_00258674 predicted 1632
7 SASI_Mm01_00258675 predicted 269
8 SASI_Mm01_00258676 predicted 931
9 SASI_Mm01_00258677 predicted 502
10 SASI_Mm01_00258678 predicted 951
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101488
GSG1L MISSION shRNA Bacterial Glycerol Stock
GSG1-like
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000251677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101488.1-1000s21c1
Sequence:CCGGTAGATCCTGAGGCCATCAAATCTCGAGATTTGATGGCCTCAGGATCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101488.1-908s21c1
Sequence:CCGGCACTACACTCAACTCCTATACCTCGAGGTATAGGAGTTGAGTGTAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101488.1-821s21c1
Sequence:CCGGTGAAGACTGGAGACCTCATTCCTCGAGGAATGAGGTCTCCAGTCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251678    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101488.1-1675s21c1
Sequence:CCGGATTACCTTACCCGAGATATAACTCGAGTTATATCTCGGGTAAGGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101488
GSG1L MISSION shRNA shRNA Plasmid DNA
GSG1-like
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000251677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101488.1-1000s21c1
Sequence:CCGGTAGATCCTGAGGCCATCAAATCTCGAGATTTGATGGCCTCAGGATCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101488.1-908s21c1
Sequence:CCGGCACTACACTCAACTCCTATACCTCGAGGTATAGGAGTTGAGTGTAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101488.1-821s21c1
Sequence:CCGGTGAAGACTGGAGACCTCATTCCTCGAGGAATGAGGTCTCCAGTCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251678    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101488.1-1675s21c1
Sequence:CCGGATTACCTTACCCGAGATATAACTCGAGTTATATCTCGGGTAAGGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101488
GSG1L MISSION shRNA Lentiviral Transduction Particles
GSG1-like
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000251677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101488.1-1000s21c1
Sequence:CCGGTAGATCCTGAGGCCATCAAATCTCGAGATTTGATGGCCTCAGGATCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101488.1-908s21c1
Sequence:CCGGCACTACACTCAACTCCTATACCTCGAGGTATAGGAGTTGAGTGTAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101488.1-821s21c1
Sequence:CCGGTGAAGACTGGAGACCTCATTCCTCGAGGAATGAGGTCTCCAGTCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251678    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101488.1-1675s21c1
Sequence:CCGGATTACCTTACCCGAGATATAACTCGAGTTATATCTCGGGTAAGGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001109763
GSG1L MISSION shRNA Bacterial Glycerol Stock
GSG1-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109763.1-936s21c1
Sequence:CCGGGCGAGGAGGACTTTCACTTAGCTCGAGCTAAGTGAAAGTCCTCCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109763.1-577s21c1
Sequence:CCGGCAATGTCATCGACGGGCTCAACTCGAGTTGAGCCCGTCGATGACATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109763.1-504s21c1
Sequence:CCGGTCTCCGAGGTGCTGTACATTCCTCGAGGAATGTACAGCACCTCGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109763.1-804s21c1
Sequence:CCGGCCTACACCAAGACGGTCATTGCTCGAGCAATGACCGTCTTGGTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001109763.1-2235s21c1
Sequence:CCGGCATCATTCGTCCATCTATTATCTCGAGATAATAGATGGACGAATGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001109763
GSG1L MISSION shRNA shRNA Plasmid DNA
GSG1-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109763.1-936s21c1
Sequence:CCGGGCGAGGAGGACTTTCACTTAGCTCGAGCTAAGTGAAAGTCCTCCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109763.1-577s21c1
Sequence:CCGGCAATGTCATCGACGGGCTCAACTCGAGTTGAGCCCGTCGATGACATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109763.1-504s21c1
Sequence:CCGGTCTCCGAGGTGCTGTACATTCCTCGAGGAATGTACAGCACCTCGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109763.1-804s21c1
Sequence:CCGGCCTACACCAAGACGGTCATTGCTCGAGCAATGACCGTCTTGGTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001109763.1-2235s21c1
Sequence:CCGGCATCATTCGTCCATCTATTATCTCGAGATAATAGATGGACGAATGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001109763
GSG1L MISSION shRNA Lentiviral Transduction Particles
GSG1-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109763.1-936s21c1
Sequence:CCGGGCGAGGAGGACTTTCACTTAGCTCGAGCTAAGTGAAAGTCCTCCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109763.1-577s21c1
Sequence:CCGGCAATGTCATCGACGGGCTCAACTCGAGTTGAGCCCGTCGATGACATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109763.1-504s21c1
Sequence:CCGGTCTCCGAGGTGCTGTACATTCCTCGAGGAATGTACAGCACCTCGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109763.1-804s21c1
Sequence:CCGGCCTACACCAAGACGGTCATTGCTCGAGCAATGACCGTCTTGGTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001109763.1-2235s21c1
Sequence:CCGGCATCATTCGTCCATCTATTATCTCGAGATAATAGATGGACGAATGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)