EMAIL THIS PAGE TO A FRIEND

GSG2

germ cell associated 2 (haspin)

60 Gene Product Result for
Synonyms: HASPIN
UniProtKB ID: Q8TF76, Q5U5K3, Q96MN1, Q9BXS7
Gene ID:
Mouse(14841) germ cell-specific gene 2
Rat(687827) germ cell associated 2 (haspin)
domestic guinea pig(100728520) germ cell associated 2 (haspin)
naked mole-rat(101724832) germ cell associated 2 (haspin)
chicken(427834) germ cell associated 2 (haspin)
cow(767819) germ cell associated 2 (haspin)
domestic cat(101091825) germ cell associated 2 (haspin)
dog(611109) germ cell associated 2 (haspin)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010353 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010353 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010353 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031965 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031965 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031965 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031965 Rosetta Predictions human pricing
XM_001080273 Rosetta Predictions rat pricing
NM_010353 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359157 predicted 1695
2 SASI_Hs01_00243245 predicted 1954
3 SASI_Hs01_00243246 predicted 796
4 SASI_Hs01_00243248 predicted 1848
5 SASI_Hs01_00243250 predicted 1787
6 SASI_Hs02_00359158 predicted 1958
7 SASI_Hs02_00359159 predicted 1690
8 SASI_Hs01_00243253 predicted 1662
9 SASI_Hs01_00243254 predicted 2308
10 SASI_Hs02_00359160 predicted 1881
11 SASI_Hs01_00243247 predicted 1048
12 SASI_Hs01_00243249 predicted 2234
13 SASI_Hs01_00243251 predicted 2256
14 SASI_Hs01_00243252 predicted 1529
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080273 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367385 predicted 1382
2 SASI_Rn02_00367386 predicted 1340
3 SASI_Rn02_00367387 predicted 1890
4 SASI_Rn02_00367388 predicted 1065
5 SASI_Rn02_00367389 predicted 1902
6 SASI_Rn02_00367390 predicted 1571
7 SASI_Rn02_00367391 predicted 2133
8 SASI_Rn02_00367392 predicted 1679
9 SASI_Rn02_00367393 predicted 2107
10 SASI_Rn02_00367394 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010353 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318373 predicted 653
2 SASI_Mm02_00318374 predicted 2196
3 SASI_Mm02_00318375 predicted 2175
4 SASI_Mm02_00318376 predicted 1188
5 SASI_Mm02_00318377 predicted 1096
6 SASI_Mm02_00318378 predicted 1559
7 SASI_Mm02_00318379 predicted 1118
8 SASI_Mm02_00318380 predicted 1484
9 SASI_Mm02_00318381 predicted 2159
10 SASI_Mm02_00318382 predicted 2024
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010353
GSG2 MISSION shRNA Bacterial Glycerol Stock
germ cell associated 2 (haspin)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010353.1-1118s21c1
Sequence:CCGGGCAGTTCTGTTGCCAGTTCTTCTCGAGAAGAACTGGCAACAGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010353.1-1628s21c1
Sequence:CCGGCCTGGGATCACTATAACACAACTCGAGTTGTGTTATAGTGATCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010353.1-2197s21c1
Sequence:CCGGGCCATGAAGCAAATAAGGAAACTCGAGTTTCCTTATTTGCTTCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010353.1-2271s21c1
Sequence:CCGGGCTCTGCCAACACAGTCTATTCTCGAGAATAGACTGTGTTGGCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010353.1-1628s1c1
Sequence:CCGGCCTGGGATCACTATAACACAACTCGAGTTGTGTTATAGTGATCCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010353.1-1118s1c1
Sequence:CCGGGCAGTTCTGTTGCCAGTTCTTCTCGAGAAGAACTGGCAACAGAACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010353.1-2197s1c1
Sequence:CCGGGCCATGAAGCAAATAAGGAAACTCGAGTTTCCTTATTTGCTTCATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010353.1-934s1c1
Sequence:CCGGCGGAAGAGGAAACAGCAAGAACTCGAGTTCTTGCTGTTTCCTCTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010353.1-2271s1c1
Sequence:CCGGGCTCTGCCAACACAGTCTATTCTCGAGAATAGACTGTGTTGGCAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010353
GSG2 MISSION shRNA shRNA Plasmid DNA
germ cell associated 2 (haspin)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010353.1-1118s21c1
Sequence:CCGGGCAGTTCTGTTGCCAGTTCTTCTCGAGAAGAACTGGCAACAGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010353.1-1628s21c1
Sequence:CCGGCCTGGGATCACTATAACACAACTCGAGTTGTGTTATAGTGATCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010353.1-2197s21c1
Sequence:CCGGGCCATGAAGCAAATAAGGAAACTCGAGTTTCCTTATTTGCTTCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010353.1-2271s21c1
Sequence:CCGGGCTCTGCCAACACAGTCTATTCTCGAGAATAGACTGTGTTGGCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010353.1-1628s1c1
Sequence:CCGGCCTGGGATCACTATAACACAACTCGAGTTGTGTTATAGTGATCCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010353.1-1118s1c1
Sequence:CCGGGCAGTTCTGTTGCCAGTTCTTCTCGAGAAGAACTGGCAACAGAACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010353.1-2197s1c1
Sequence:CCGGGCCATGAAGCAAATAAGGAAACTCGAGTTTCCTTATTTGCTTCATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010353.1-934s1c1
Sequence:CCGGCGGAAGAGGAAACAGCAAGAACTCGAGTTCTTGCTGTTTCCTCTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010353.1-2271s1c1
Sequence:CCGGGCTCTGCCAACACAGTCTATTCTCGAGAATAGACTGTGTTGGCAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010353
GSG2 MISSION shRNA Lentiviral Transduction Particles
germ cell associated 2 (haspin)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010353.1-1118s21c1
Sequence:CCGGGCAGTTCTGTTGCCAGTTCTTCTCGAGAAGAACTGGCAACAGAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010353.1-1628s21c1
Sequence:CCGGCCTGGGATCACTATAACACAACTCGAGTTGTGTTATAGTGATCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010353.1-2197s21c1
Sequence:CCGGGCCATGAAGCAAATAAGGAAACTCGAGTTTCCTTATTTGCTTCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010353.1-2271s21c1
Sequence:CCGGGCTCTGCCAACACAGTCTATTCTCGAGAATAGACTGTGTTGGCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010353.1-1628s1c1
Sequence:CCGGCCTGGGATCACTATAACACAACTCGAGTTGTGTTATAGTGATCCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010353.1-1118s1c1
Sequence:CCGGGCAGTTCTGTTGCCAGTTCTTCTCGAGAAGAACTGGCAACAGAACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010353.1-2197s1c1
Sequence:CCGGGCCATGAAGCAAATAAGGAAACTCGAGTTTCCTTATTTGCTTCATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010353.1-934s1c1
Sequence:CCGGCGGAAGAGGAAACAGCAAGAACTCGAGTTCTTGCTGTTTCCTCTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010353.1-2271s1c1
Sequence:CCGGGCTCTGCCAACACAGTCTATTCTCGAGAATAGACTGTGTTGGCAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031965
VALIDATED
GSG2 MISSION shRNA Bacterial Glycerol Stock
germ cell associated 2 (haspin)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031965.2-1754s21c1
Sequence:CCGGTCAAAGCCTGGGATCACTATACTCGAGTATAGTGATCCCAGGCTTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031965.2-2236s21c1
Sequence:CCGGGAATATCACCCTTATAGTAATCTCGAGATTACTATAAGGGTGATATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031965.2-1573s21c1
Sequence:GTACCGGGCTATTGAAGGACCAGATTTACTCGAGTAAATCTGGTCCTTCAATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031965.2-2570s21c1
Sequence:CCGGTTCCAAATGGAAACTGAAATACTCGAGTATTTCAGTTTCCATTTGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031965.2-2171s21c1
Sequence:CCGGGTGACGGTGACTACCAGTTTGCTCGAGCAAACTGGTAGTCACCGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031965.2-2171s1c1
Sequence:CCGGGTGACGGTGACTACCAGTTTGCTCGAGCAAACTGGTAGTCACCGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031965.2-2147s1c1
Sequence:CCGGCCATGGATGAGGACCTGTTTACTCGAGTAAACAGGTCCTCATCCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031965.2-2296s1c1
Sequence:CCGGCAAATGACCTTCAAGACTAAACTCGAGTTTAGTCTTGAAGGTCATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196907    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031965.2-2625s1c1
Sequence:CCGGGTTCTGAAAGAAGTAAACTAGCTCGAGCTAGTTTACTTCTTTCAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031965.1-1273s1c1
Sequence:CCGGCCCTCCTATCAGAATGTTCAACTCGAGTTGAACATTCTGATAGGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031965.1-1756s1c1
Sequence:CCGGCCTGGGATCACTATAATTCAACTCGAGTTGAATTATAGTGATCCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031965.1-1342s1c1
Sequence:CCGGCCTCCTCTATGTATTTGCTAACTCGAGTTAGCAAATACATAGAGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031965.1-2360s1c1
Sequence:CCGGCCACAGGACAATGCTGAACTTCTCGAGAAGTTCAGCATTGTCCTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021529    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031965.1-2608s1c1
Sequence:CCGGGCTGATAACAAATGTTCTGAACTCGAGTTCAGAACATTTGTTATCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031965
VALIDATED
GSG2 MISSION shRNA shRNA Plasmid DNA
germ cell associated 2 (haspin)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031965.2-1754s21c1
Sequence:CCGGTCAAAGCCTGGGATCACTATACTCGAGTATAGTGATCCCAGGCTTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031965.2-2236s21c1
Sequence:CCGGGAATATCACCCTTATAGTAATCTCGAGATTACTATAAGGGTGATATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031965.2-1573s21c1
Sequence:GTACCGGGCTATTGAAGGACCAGATTTACTCGAGTAAATCTGGTCCTTCAATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031965.2-2570s21c1
Sequence:CCGGTTCCAAATGGAAACTGAAATACTCGAGTATTTCAGTTTCCATTTGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031965.2-2171s21c1
Sequence:CCGGGTGACGGTGACTACCAGTTTGCTCGAGCAAACTGGTAGTCACCGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031965.2-2171s1c1
Sequence:CCGGGTGACGGTGACTACCAGTTTGCTCGAGCAAACTGGTAGTCACCGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031965.2-2147s1c1
Sequence:CCGGCCATGGATGAGGACCTGTTTACTCGAGTAAACAGGTCCTCATCCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031965.2-2296s1c1
Sequence:CCGGCAAATGACCTTCAAGACTAAACTCGAGTTTAGTCTTGAAGGTCATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196907    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031965.2-2625s1c1
Sequence:CCGGGTTCTGAAAGAAGTAAACTAGCTCGAGCTAGTTTACTTCTTTCAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031965.1-1273s1c1
Sequence:CCGGCCCTCCTATCAGAATGTTCAACTCGAGTTGAACATTCTGATAGGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031965.1-1756s1c1
Sequence:CCGGCCTGGGATCACTATAATTCAACTCGAGTTGAATTATAGTGATCCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031965.1-1342s1c1
Sequence:CCGGCCTCCTCTATGTATTTGCTAACTCGAGTTAGCAAATACATAGAGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031965.1-2360s1c1
Sequence:CCGGCCACAGGACAATGCTGAACTTCTCGAGAAGTTCAGCATTGTCCTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021529    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031965.1-2608s1c1
Sequence:CCGGGCTGATAACAAATGTTCTGAACTCGAGTTCAGAACATTTGTTATCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031965
VALIDATED
GSG2 MISSION shRNA Lentiviral Transduction Particles
germ cell associated 2 (haspin)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031965.2-1754s21c1
Sequence:CCGGTCAAAGCCTGGGATCACTATACTCGAGTATAGTGATCCCAGGCTTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031965.2-2236s21c1
Sequence:CCGGGAATATCACCCTTATAGTAATCTCGAGATTACTATAAGGGTGATATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031965.2-1573s21c1
Sequence:GTACCGGGCTATTGAAGGACCAGATTTACTCGAGTAAATCTGGTCCTTCAATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031965.2-2570s21c1
Sequence:CCGGTTCCAAATGGAAACTGAAATACTCGAGTATTTCAGTTTCCATTTGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031965.2-2171s21c1
Sequence:CCGGGTGACGGTGACTACCAGTTTGCTCGAGCAAACTGGTAGTCACCGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031965.2-2171s1c1
Sequence:CCGGGTGACGGTGACTACCAGTTTGCTCGAGCAAACTGGTAGTCACCGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031965.2-2147s1c1
Sequence:CCGGCCATGGATGAGGACCTGTTTACTCGAGTAAACAGGTCCTCATCCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031965.2-2296s1c1
Sequence:CCGGCAAATGACCTTCAAGACTAAACTCGAGTTTAGTCTTGAAGGTCATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196907    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031965.2-2625s1c1
Sequence:CCGGGTTCTGAAAGAAGTAAACTAGCTCGAGCTAGTTTACTTCTTTCAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031965.1-1273s1c1
Sequence:CCGGCCCTCCTATCAGAATGTTCAACTCGAGTTGAACATTCTGATAGGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031965.1-1756s1c1
Sequence:CCGGCCTGGGATCACTATAATTCAACTCGAGTTGAATTATAGTGATCCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031965.1-1342s1c1
Sequence:CCGGCCTCCTCTATGTATTTGCTAACTCGAGTTAGCAAATACATAGAGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031965.1-2360s1c1
Sequence:CCGGCCACAGGACAATGCTGAACTTCTCGAGAAGTTCAGCATTGTCCTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021529    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031965.1-2608s1c1
Sequence:CCGGGCTGATAACAAATGTTCTGAACTCGAGTTCAGAACATTTGTTATCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)