EMAIL THIS PAGE TO A FRIEND

GSK3A

glycogen synthase kinase 3 alpha

110 Gene Product Result for
UniProtKB ID: P49840, O14959
Gene ID:
Human(2931) Summary: This gene encodes a multifunctional Ser/Thr protein kinase that is implicated in the control of several regulatory proteins including glycogen synthase, and transcription factors, such as JUN. It also plays a role in the WNT and PI3K signaling pathways, as well as regulates the production of beta-amyloid peptides associated with Alzheimer's disease. [provided by RefSeq, Oct 2011]
Mouse(606496) glycogen synthase kinase 3 alpha
Rat(50686) glycogen synthase kinase 3 alpha
dog(484476) glycogen synthase kinase 3 alpha
domestic cat(101084151) glycogen synthase kinase 3 alpha
cow(536561) glycogen synthase kinase 3 alpha
sheep(101102753) glycogen synthase kinase 3 alpha
domestic guinea pig(100736092) glycogen synthase kinase 3 alpha
naked mole-rat(101717440) glycogen synthase kinase 3 alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501330 Anti-GSK3 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4300292 Anti-GSK3A (Ab-21) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
GW22778 Anti-GSK3a antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, western blot pricing
AV01028 Anti-GSK3A antibody produced in rabbit IgG fraction of antiserum mouse, pig, bovine, human, canine, rat
western blot pricing
HPA028423 Anti-GSK3A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
G5791 Anti-phospho-Glycogen Synthase Kinase 3α/β (pTyr279/216) antibody produced in rabbit affinity isolated antibody, aqueous glycerol solution mouse, rat, human
dot blot, ELISA, western blot pricing
SAB4504419 Anti-phospho-GSK3 α (pSer21) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4503763 Anti-phospho-GSK3 α/β (pTyr279/216) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4300006 Anti-phospho-GSK3A (pSer21) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB5300284 Monoclonal Anti-GSK3A antibody produced in mouse clone 6G2F1, ascites fluid human
ELISA, immunohistochemistry, western blot pricing
SAB5300285 Monoclonal Anti-GSK3A antibody produced in mouse clone 9D5G1, ascites fluid human
ELISA, immunofluorescence, western blot pricing
SAB5300286 Monoclonal Anti-GSK3A antibody produced in mouse clone 6G12C2, ascites fluid human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019884 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019884 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019884 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001031667 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001031667 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001031667 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019884 Rosetta Predictions human pricing
NM_017344 Rosetta Predictions rat pricing
XM_579413 Rosetta Predictions rat pricing
NM_001031667 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019884 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245062 predicted 731
2 SASI_Hs02_00352896 predicted 984
3 SASI_Hs01_00245063 predicted 433
4 SASI_Hs01_00245064 predicted 550
5 SASI_Hs01_00245065 predicted 477
6 SASI_Hs01_00245066 predicted 1347
7 SASI_Hs01_00245067 predicted 484
8 SASI_Hs01_00245068 predicted 1420
9 SASI_Hs01_00245069 predicted 996
10 SASI_Hs01_00245070 predicted 460
11 SASI_Hs01_00245071 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017344 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048738 predicted 476
2 SASI_Rn01_00048739 predicted 1390
3 SASI_Rn01_00048740 predicted 1156
4 SASI_Rn01_00048741 predicted 561
5 SASI_Rn01_00048743 predicted 760
6 SASI_Rn01_00048744 predicted 485
7 SASI_Rn02_00261815 predicted 739
8 SASI_Rn02_00261816 predicted 1142
9 SASI_Rn01_00048745 predicted 1168
10 SASI_Rn01_00048746 predicted 1151
11 SASI_Rn01_00048742 predicted 1433
12 SASI_Rn01_00048747 predicted 1168
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579413 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00191764 predicted 1160
2 SASI_Rn01_00191765 predicted 1234
3 SASI_Rn01_00191766 predicted 1036
4 SASI_Rn01_00191767 predicted 1167
5 SASI_Rn01_00191768 predicted 1214
6 SASI_Rn01_00191769 predicted 1100
7 SASI_Rn01_00191770 predicted 1169
8 SASI_Rn01_00191771 predicted 958
9 SASI_Rn01_00191772 predicted 1169
10 SASI_Rn01_00191773 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031667 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126759 predicted 1226
2 SASI_Mm01_00126760 predicted 546
3 SASI_Mm01_00126761 predicted 1254
4 SASI_Mm01_00126762 predicted 1037
5 SASI_Mm01_00126763 predicted 1020
6 SASI_Mm01_00126764 predicted 1217
7 SASI_Mm01_00126765 predicted 1572
8 SASI_Mm01_00126766 predicted 536
9 SASI_Mm01_00126767 predicted 528
10 SASI_Mm01_00126768 predicted 1047
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019884
VALIDATED
GSK3A MISSION shRNA Bacterial Glycerol Stock
glycogen synthase kinase 3 alpha
Human
20 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.1-462s1c1
Sequence:CCGGAGTGGCTTACACGGACATCAACTCGAGTTGATGTCCGTGTAAGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.1-1134s1c1
Sequence:CCGGCCGGGAACAAATCCGAGAGATCTCGAGATCTCTCGGATTTGTTCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.1-1375s1c1
Sequence:CCGGCCTCTCTTCAACTTCAGTGCTCTCGAGAGCACTGAAGTTGAAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.1-948s1c1
Sequence:CCGGCTACATCTGTTCTCGCTACTACTCGAGTAGTAGCGAGAACAGATGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019884.1-1874s1c1
Sequence:CCGGCTGTGTCCCTTGTAAATAGAACTCGAGTTCTATTTACAAGGGACACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.1-1173s1c1
Sequence:CCGGGTTCAAGTTCCCTCAGATTAACTCGAGTTAATCTGAGGGAACTTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.1-567s1c1
Sequence:CCGGCCAGGACAAGAGGTTCAAGAACTCGAGTTCTTGAACCTCTTGTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.1-473s1c1
Sequence:CCGGCGGACATCAAAGTGATTGGCACTCGAGTGCCAATCACTTTGATGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.2-1581s1c1
Sequence:CCGGCAAGCACCCTTCCACTTCCATCTCGAGATGGAAGTGGAAGGGTGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019884.2-1207s1c1
Sequence:CCGGCCTGGACAAAGGTGTTCAAATCTCGAGATTTGAACACCTTTGTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.2-1937s1c1
Sequence:CCGGCGGGTGTAAATAGATTGTTATCTCGAGATAACAATCTATTTACACCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019884.2-668s1c1
Sequence:CCGGCGAGAAGAAAGACGAGCTTTACTCGAGTAAAGCTCGTCTTTCTTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199165    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.2-1634s1c1
Sequence:CCGGCCATAGCCCATCAAGCTCCTGCTCGAGCAGGAGCTTGATGGGCTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.2-1682s1c1
Sequence:CCGGCAGAGGTAAATGAGTCCCTGTCTCGAGACAGGGACTCATTTACCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019884.2-617s1c1
Sequence:CCGGGCTGGACCACTGCAATATTGTCTCGAGACAATATTGCAGTGGTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019884.2-617s21c1
Sequence:CCGGGCTGGACCACTGCAATATTGTCTCGAGACAATATTGCAGTGGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019884.2-1634s21c1
Sequence:CCGGCCATAGCCCATCAAGCTCCTGCTCGAGCAGGAGCTTGATGGGCTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019884.2-1178s21c1
Sequence:CCGGGTTCAAGTTCCCTCAGATTAACTCGAGTTAATCTGAGGGAACTTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019884.2-953s21c1
Sequence:CCGGCTACATCTGTTCTCGCTACTACTCGAGTAGTAGCGAGAACAGATGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019884.2-1672s21c1
Sequence:CCGGGACTAGAGGGCAGAGGTAAATCTCGAGATTTACCTCTGCCCTCTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019884
VALIDATED
GSK3A MISSION shRNA shRNA Plasmid DNA
glycogen synthase kinase 3 alpha
Human
20 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.1-462s1c1
Sequence:CCGGAGTGGCTTACACGGACATCAACTCGAGTTGATGTCCGTGTAAGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.1-1134s1c1
Sequence:CCGGCCGGGAACAAATCCGAGAGATCTCGAGATCTCTCGGATTTGTTCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.1-1375s1c1
Sequence:CCGGCCTCTCTTCAACTTCAGTGCTCTCGAGAGCACTGAAGTTGAAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.1-948s1c1
Sequence:CCGGCTACATCTGTTCTCGCTACTACTCGAGTAGTAGCGAGAACAGATGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019884.1-1874s1c1
Sequence:CCGGCTGTGTCCCTTGTAAATAGAACTCGAGTTCTATTTACAAGGGACACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.1-1173s1c1
Sequence:CCGGGTTCAAGTTCCCTCAGATTAACTCGAGTTAATCTGAGGGAACTTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.1-567s1c1
Sequence:CCGGCCAGGACAAGAGGTTCAAGAACTCGAGTTCTTGAACCTCTTGTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.1-473s1c1
Sequence:CCGGCGGACATCAAAGTGATTGGCACTCGAGTGCCAATCACTTTGATGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.2-1581s1c1
Sequence:CCGGCAAGCACCCTTCCACTTCCATCTCGAGATGGAAGTGGAAGGGTGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019884.2-1207s1c1
Sequence:CCGGCCTGGACAAAGGTGTTCAAATCTCGAGATTTGAACACCTTTGTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.2-1937s1c1
Sequence:CCGGCGGGTGTAAATAGATTGTTATCTCGAGATAACAATCTATTTACACCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019884.2-668s1c1
Sequence:CCGGCGAGAAGAAAGACGAGCTTTACTCGAGTAAAGCTCGTCTTTCTTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199165    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.2-1634s1c1
Sequence:CCGGCCATAGCCCATCAAGCTCCTGCTCGAGCAGGAGCTTGATGGGCTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.2-1682s1c1
Sequence:CCGGCAGAGGTAAATGAGTCCCTGTCTCGAGACAGGGACTCATTTACCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019884.2-617s1c1
Sequence:CCGGGCTGGACCACTGCAATATTGTCTCGAGACAATATTGCAGTGGTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019884.2-617s21c1
Sequence:CCGGGCTGGACCACTGCAATATTGTCTCGAGACAATATTGCAGTGGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019884.2-1634s21c1
Sequence:CCGGCCATAGCCCATCAAGCTCCTGCTCGAGCAGGAGCTTGATGGGCTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019884.2-1178s21c1
Sequence:CCGGGTTCAAGTTCCCTCAGATTAACTCGAGTTAATCTGAGGGAACTTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019884.2-953s21c1
Sequence:CCGGCTACATCTGTTCTCGCTACTACTCGAGTAGTAGCGAGAACAGATGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019884.2-1672s21c1
Sequence:CCGGGACTAGAGGGCAGAGGTAAATCTCGAGATTTACCTCTGCCCTCTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019884
VALIDATED
GSK3A MISSION shRNA Lentiviral Transduction Particles
glycogen synthase kinase 3 alpha
Human
20 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.1-462s1c1
Sequence:CCGGAGTGGCTTACACGGACATCAACTCGAGTTGATGTCCGTGTAAGCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.1-1134s1c1
Sequence:CCGGCCGGGAACAAATCCGAGAGATCTCGAGATCTCTCGGATTTGTTCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.1-1375s1c1
Sequence:CCGGCCTCTCTTCAACTTCAGTGCTCTCGAGAGCACTGAAGTTGAAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.1-948s1c1
Sequence:CCGGCTACATCTGTTCTCGCTACTACTCGAGTAGTAGCGAGAACAGATGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019884.1-1874s1c1
Sequence:CCGGCTGTGTCCCTTGTAAATAGAACTCGAGTTCTATTTACAAGGGACACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.1-1173s1c1
Sequence:CCGGGTTCAAGTTCCCTCAGATTAACTCGAGTTAATCTGAGGGAACTTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.1-567s1c1
Sequence:CCGGCCAGGACAAGAGGTTCAAGAACTCGAGTTCTTGAACCTCTTGTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.1-473s1c1
Sequence:CCGGCGGACATCAAAGTGATTGGCACTCGAGTGCCAATCACTTTGATGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.2-1581s1c1
Sequence:CCGGCAAGCACCCTTCCACTTCCATCTCGAGATGGAAGTGGAAGGGTGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019884.2-1207s1c1
Sequence:CCGGCCTGGACAAAGGTGTTCAAATCTCGAGATTTGAACACCTTTGTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.2-1937s1c1
Sequence:CCGGCGGGTGTAAATAGATTGTTATCTCGAGATAACAATCTATTTACACCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019884.2-668s1c1
Sequence:CCGGCGAGAAGAAAGACGAGCTTTACTCGAGTAAAGCTCGTCTTTCTTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199165    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.2-1634s1c1
Sequence:CCGGCCATAGCCCATCAAGCTCCTGCTCGAGCAGGAGCTTGATGGGCTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019884.2-1682s1c1
Sequence:CCGGCAGAGGTAAATGAGTCCCTGTCTCGAGACAGGGACTCATTTACCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019884.2-617s1c1
Sequence:CCGGGCTGGACCACTGCAATATTGTCTCGAGACAATATTGCAGTGGTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019884.2-617s21c1
Sequence:CCGGGCTGGACCACTGCAATATTGTCTCGAGACAATATTGCAGTGGTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019884.2-1634s21c1
Sequence:CCGGCCATAGCCCATCAAGCTCCTGCTCGAGCAGGAGCTTGATGGGCTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019884.2-1178s21c1
Sequence:CCGGGTTCAAGTTCCCTCAGATTAACTCGAGTTAATCTGAGGGAACTTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019884.2-953s21c1
Sequence:CCGGCTACATCTGTTCTCGCTACTACTCGAGTAGTAGCGAGAACAGATGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019884.2-1672s21c1
Sequence:CCGGGACTAGAGGGCAGAGGTAAATCTCGAGATTTACCTCTGCCCTCTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001031667
VALIDATED
GSK3A MISSION shRNA Bacterial Glycerol Stock
glycogen synthase kinase 3 alpha
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_001031667.1-552s1c1
Sequence:CCGGGACATCAAAGTGATTGGTAATCTCGAGATTACCAATCACTTTGATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031667.1-752s1c1
Sequence:CCGGCGAGCTGTATTTGAATCTGGTCTCGAGACCAGATTCAAATACAGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_001031667.1-1225s1c1
Sequence:CCGGGAGAGATGAACCCTAACTATACTCGAGTATAGTTAGGGTTCATCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_001031667.1-2033s1c1
Sequence:CCGGTGGGTGTAAATAGATTGTTATCTCGAGATAACAATCTATTTACACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_001031667.1-573s1c1
Sequence:CCGGGGCTCATTCGGAGTAGTATACCTCGAGGTATACTACTCCGAATGAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001031667.1-1279s21c1
Sequence:CCGGCTTGGACAAAGGTGTTCAAATCTCGAGATTTGAACACCTTTGTCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001031667.1-686s21c1
Sequence:CCGGTAAGCTGGACCACTGCAATATCTCGAGATATTGCAGTGGTCCAGCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001031667.1-662s21c1
Sequence:CCGGGAACCGAGAACTGCAGATTATCTCGAGATAATCTGCAGTTCTCGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001031667.1-1765s21c1
Sequence:CCGGGACTAGAGGGCAGAGGTAAATCTCGAGATTTACCTCTGCCCTCTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001031667.1-1573s21c1
Sequence:CCGGACCCATCCTCACAAGCTTTAACTCGAGTTAAAGCTTGTGAGGATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001031667
VALIDATED
GSK3A MISSION shRNA shRNA Plasmid DNA
glycogen synthase kinase 3 alpha
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_001031667.1-552s1c1
Sequence:CCGGGACATCAAAGTGATTGGTAATCTCGAGATTACCAATCACTTTGATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031667.1-752s1c1
Sequence:CCGGCGAGCTGTATTTGAATCTGGTCTCGAGACCAGATTCAAATACAGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_001031667.1-1225s1c1
Sequence:CCGGGAGAGATGAACCCTAACTATACTCGAGTATAGTTAGGGTTCATCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_001031667.1-2033s1c1
Sequence:CCGGTGGGTGTAAATAGATTGTTATCTCGAGATAACAATCTATTTACACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_001031667.1-573s1c1
Sequence:CCGGGGCTCATTCGGAGTAGTATACCTCGAGGTATACTACTCCGAATGAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001031667.1-1279s21c1
Sequence:CCGGCTTGGACAAAGGTGTTCAAATCTCGAGATTTGAACACCTTTGTCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001031667.1-686s21c1
Sequence:CCGGTAAGCTGGACCACTGCAATATCTCGAGATATTGCAGTGGTCCAGCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001031667.1-662s21c1
Sequence:CCGGGAACCGAGAACTGCAGATTATCTCGAGATAATCTGCAGTTCTCGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001031667.1-1765s21c1
Sequence:CCGGGACTAGAGGGCAGAGGTAAATCTCGAGATTTACCTCTGCCCTCTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001031667.1-1573s21c1
Sequence:CCGGACCCATCCTCACAAGCTTTAACTCGAGTTAAAGCTTGTGAGGATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001031667
VALIDATED
GSK3A MISSION shRNA Lentiviral Transduction Particles
glycogen synthase kinase 3 alpha
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_001031667.1-552s1c1
Sequence:CCGGGACATCAAAGTGATTGGTAATCTCGAGATTACCAATCACTTTGATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031667.1-752s1c1
Sequence:CCGGCGAGCTGTATTTGAATCTGGTCTCGAGACCAGATTCAAATACAGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_001031667.1-1225s1c1
Sequence:CCGGGAGAGATGAACCCTAACTATACTCGAGTATAGTTAGGGTTCATCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_001031667.1-2033s1c1
Sequence:CCGGTGGGTGTAAATAGATTGTTATCTCGAGATAACAATCTATTTACACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_001031667.1-573s1c1
Sequence:CCGGGGCTCATTCGGAGTAGTATACCTCGAGGTATACTACTCCGAATGAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001031667.1-1279s21c1
Sequence:CCGGCTTGGACAAAGGTGTTCAAATCTCGAGATTTGAACACCTTTGTCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001031667.1-686s21c1
Sequence:CCGGTAAGCTGGACCACTGCAATATCTCGAGATATTGCAGTGGTCCAGCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001031667.1-662s21c1
Sequence:CCGGGAACCGAGAACTGCAGATTATCTCGAGATAATCTGCAGTTCTCGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001031667.1-1765s21c1
Sequence:CCGGGACTAGAGGGCAGAGGTAAATCTCGAGATTTACCTCTGCCCTCTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001031667.1-1573s21c1
Sequence:CCGGACCCATCCTCACAAGCTTTAACTCGAGTTAAAGCTTGTGAGGATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)