EMAIL THIS PAGE TO A FRIEND

GSK3B

glycogen synthase kinase 3 beta

105 Gene Product Result for
UniProtKB ID: P49841, D3DN89, Q9BWH3, Q9UL47
Gene ID:
Human(2932) Summary: The protein encoded by this gene is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in this gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Mouse(56637) glycogen synthase kinase 3 beta
Rat(84027) glycogen synthase kinase 3 beta
Zebrafish(30654) glycogen synthase kinase 3 beta
domestic cat(101081660) glycogen synthase kinase 3 beta
cow(790875) glycogen synthase kinase 3 beta
Horse(100061033) glycogen synthase kinase 3 beta
dog(478575) glycogen synthase kinase 3 beta
chicken(418335) glycogen synthase kinase 3 beta
domestic guinea pig(100714392) glycogen synthase kinase 3 beta
naked mole-rat(101701301) glycogen synthase kinase 3 beta
sheep(100169938) glycogen synthase kinase 3 beta
Domestic Rabbit(100348842) glycogen synthase kinase 3 beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
G7914 Anti-Glycogen Synthase Kinase-3β (GSK-3β) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human
microarray, western blot pricing
SAB4300547 Anti-GSK3B (Ab-216) antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
SAB4300287 Anti-GSK3B (Ab-9) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
GW22779 Anti-GSK3b antibody produced in chicken affinity isolated antibody, buffered aqueous solution rat, mouse, human
ELISA, western blot pricing
SAB2100978 Anti-GSK3B antibody produced in rabbit affinity isolated antibody bovine, zebrafish, human, rabbit, goat, mouse, rat, guinea pig, horse, sheep, canine, pig
western blot pricing
HPA028017 Anti-GSK3B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300001 Anti-phospho-GSK3B (pSer9) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300237 Anti-phospho-GSK3B (pTyr216) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
WH0002932M4 Monoclonal Anti-GSK3B antibody produced in mouse clone 1H3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, proximity ligation assay, western blot pricing
SAB5300175 Monoclonal Anti-GSK3B antibody produced in mouse clone 3D10, ascites fluid rat, human, mouse, monkey
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
PLA0232 Rabbit anti-GSK3-beta Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. rabbit, guinea pig, dog, human, zebrafish, pig, rhesus monkey, sheep, rat, toad, mouse, bovine
immunoprecipitation, proximity ligation assay, western blot pricing

Cell Lines

Product # Description Species Add to Cart
 
CLLS1044 MCF10A CELLS GSK3B (-/-) human pricing

Activity Assay

Product # Description Species Add to Cart
 
CS0990 GSK-3β Activity Assay Kit sufficient for 50 assays human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019827 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019827 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019827 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002093 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002093 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002093 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002093 siRNAs that have been validated in the lab human pricing
NM_032080 Rosetta Predictions rat pricing
NM_019827 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002093 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192106 validated 625
1 SASI_Hs01_00192105 validated 1356
2 SASI_Hs01_00192104 predicted 657
3 SASI_Hs01_00192108 predicted 585
4 SASI_Hs01_00192109 predicted 1107
5 SASI_Hs01_00192110 predicted 411
6 SASI_Hs01_00192111 predicted 1318
7 SASI_Hs02_00333189 predicted 890
8 SASI_Hs01_00192112 predicted 736
9 SASI_Hs01_00192113 predicted 922
10 SASI_Hs01_00192107 predicted 1098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032080 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035805 predicted 562
2 SASI_Rn01_00035806 predicted 879
3 SASI_Rn01_00035807 predicted 353
4 SASI_Rn01_00035808 predicted 1218
5 SASI_Rn01_00035809 predicted 685
6 SASI_Rn02_00265457 predicted 879
7 SASI_Rn01_00035810 predicted 315
8 SASI_Rn01_00035811 predicted 627
9 SASI_Rn01_00035812 predicted 1182
10 SASI_Rn02_00265458 predicted 301
11 SASI_Rn01_00035813 predicted 306
12 SASI_Rn01_00035814 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019827 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141909 predicted 1950
2 SASI_Mm01_00141910 predicted 2407
3 SASI_Mm01_00141911 predicted 2068
4 SASI_Mm01_00141912 predicted 1700
5 SASI_Mm01_00141913 predicted 2260
6 SASI_Mm02_00325122 predicted 1976
7 SASI_Mm01_00141914 predicted 1783
8 SASI_Mm01_00141915 predicted 2563
9 SASI_Mm01_00141916 predicted 2030
10 SASI_Mm01_00141917 predicted 1683
11 SASI_Mm01_00141918 predicted 2024
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019827
VALIDATED
GSK3B MISSION shRNA Bacterial Glycerol Stock
glycogen synthase kinase 3 beta
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019827.6-2075s21c1
Sequence:CCGGCCACAGAACCTCTTGTTGGATCTCGAGATCCAACAAGAGGTTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294541    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019827.6-3110s21c1
Sequence:CCGGTCCGCTATTGTATACCTTAAACTCGAGTTTAAGGTATACAATAGCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019827.6-2613s21c1
Sequence:CCGGCCACTCAAGAACTGTCAAGTACTCGAGTACTTGACAGTTCTTGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019827.6-2555s21c1
Sequence:CCGGCGGGACCCAAATGTCAAACTACTCGAGTAGTTTGACATTTGGGTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019827.6-1600s21c1
Sequence:CCGGCATGAAAGTTAGCAGAGATAACTCGAGTTATCTCTGCTAACTTTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019827.2-1812s1c1
Sequence:CCGGCGAGAAGAAAGATGAGGTCTACTCGAGTAGACCTCATCTTTCTTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019827.2-2540s1c1
Sequence:CCGGCCACTCAAGAACTGTCAAGTACTCGAGTACTTGACAGTTCTTGAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019827.2-1527s1c1
Sequence:CCGGCATGAAAGTTAGCAGAGATAACTCGAGTTATCTCTGCTAACTTTCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019827.2-2482s1c1
Sequence:CCGGCGGGACCCAAATGTCAAACTACTCGAGTAGTTTGACATTTGGGTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019827.2-2002s1c1
Sequence:CCGGCCACAGAACCTCTTGTTGGATCTCGAGATCCAACAAGAGGTTCTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019827
VALIDATED
GSK3B MISSION shRNA shRNA Plasmid DNA
glycogen synthase kinase 3 beta
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019827.6-2075s21c1
Sequence:CCGGCCACAGAACCTCTTGTTGGATCTCGAGATCCAACAAGAGGTTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294541    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019827.6-3110s21c1
Sequence:CCGGTCCGCTATTGTATACCTTAAACTCGAGTTTAAGGTATACAATAGCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019827.6-2613s21c1
Sequence:CCGGCCACTCAAGAACTGTCAAGTACTCGAGTACTTGACAGTTCTTGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019827.6-2555s21c1
Sequence:CCGGCGGGACCCAAATGTCAAACTACTCGAGTAGTTTGACATTTGGGTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019827.6-1600s21c1
Sequence:CCGGCATGAAAGTTAGCAGAGATAACTCGAGTTATCTCTGCTAACTTTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019827.2-1812s1c1
Sequence:CCGGCGAGAAGAAAGATGAGGTCTACTCGAGTAGACCTCATCTTTCTTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019827.2-2540s1c1
Sequence:CCGGCCACTCAAGAACTGTCAAGTACTCGAGTACTTGACAGTTCTTGAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019827.2-1527s1c1
Sequence:CCGGCATGAAAGTTAGCAGAGATAACTCGAGTTATCTCTGCTAACTTTCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019827.2-2482s1c1
Sequence:CCGGCGGGACCCAAATGTCAAACTACTCGAGTAGTTTGACATTTGGGTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019827.2-2002s1c1
Sequence:CCGGCCACAGAACCTCTTGTTGGATCTCGAGATCCAACAAGAGGTTCTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019827
VALIDATED
GSK3B MISSION shRNA Lentiviral Transduction Particles
glycogen synthase kinase 3 beta
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019827.6-2075s21c1
Sequence:CCGGCCACAGAACCTCTTGTTGGATCTCGAGATCCAACAAGAGGTTCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294541    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019827.6-3110s21c1
Sequence:CCGGTCCGCTATTGTATACCTTAAACTCGAGTTTAAGGTATACAATAGCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019827.6-2613s21c1
Sequence:CCGGCCACTCAAGAACTGTCAAGTACTCGAGTACTTGACAGTTCTTGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019827.6-2555s21c1
Sequence:CCGGCGGGACCCAAATGTCAAACTACTCGAGTAGTTTGACATTTGGGTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019827.6-1600s21c1
Sequence:CCGGCATGAAAGTTAGCAGAGATAACTCGAGTTATCTCTGCTAACTTTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019827.2-1812s1c1
Sequence:CCGGCGAGAAGAAAGATGAGGTCTACTCGAGTAGACCTCATCTTTCTTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019827.2-2540s1c1
Sequence:CCGGCCACTCAAGAACTGTCAAGTACTCGAGTACTTGACAGTTCTTGAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019827.2-1527s1c1
Sequence:CCGGCATGAAAGTTAGCAGAGATAACTCGAGTTATCTCTGCTAACTTTCATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019827.2-2482s1c1
Sequence:CCGGCGGGACCCAAATGTCAAACTACTCGAGTAGTTTGACATTTGGGTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019827.2-2002s1c1
Sequence:CCGGCCACAGAACCTCTTGTTGGATCTCGAGATCCAACAAGAGGTTCTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002093
VALIDATED
GSK3B MISSION shRNA Bacterial Glycerol Stock
glycogen synthase kinase 3 beta
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002093.2-1292s1c1
Sequence:CCGGGATGAATTACGGGACCCAAATCTCGAGATTTGGGTCCCGTAATTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002093.2-974s1c1
Sequence:CCGGGCTGAGCTGTTACTAGGACAACTCGAGTTGTCCTAGTAACAGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002093.2-496s1c1
Sequence:CCGGGCAGGACAAGAGATTTAAGAACTCGAGTTCTTAAATCTCTTGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002093.2-1087s1c1
Sequence:CCGGCCCAAACTACACAGAATTTAACTCGAGTTAAATTCTGTGTAGTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002093.2-404s1c1
Sequence:CCGGGACACTAAAGTGATTGGAAATCTCGAGATTTCCAATCACTTTAGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002093.2-924s1c1
Sequence:CCGGCCACTGATTATACCTCTAGTACTCGAGTACTAGAGGTATAATCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002093.x-1596s1c1
Sequence:CCGGCACTGGTCACGTTTGGAAAGACTCGAGTCTTTCCAAACGTGACCAGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002093.x-867s1c1
Sequence:CCGGCCAATGTTTCGTATATCTGTTCTCGAGAACAGATATACGAAACATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002093.x-562s1c1
Sequence:CCGGCCGATTGCGTTATTTCTTCTACTCGAGTAGAAGAAATAACGCAATCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002093.x-1306s1c1
Sequence:CCGGCCCAAATGTCAAACTACCAAACTCGAGTTTGGTAGTTTGACATTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002093.x-1017s1c1
Sequence:CCGGGTGTGGATCAGTTGGTAGAAACTCGAGTTTCTACCAACTGATCCACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002093
VALIDATED
GSK3B MISSION shRNA shRNA Plasmid DNA
glycogen synthase kinase 3 beta
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002093.2-1292s1c1
Sequence:CCGGGATGAATTACGGGACCCAAATCTCGAGATTTGGGTCCCGTAATTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002093.2-974s1c1
Sequence:CCGGGCTGAGCTGTTACTAGGACAACTCGAGTTGTCCTAGTAACAGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002093.2-496s1c1
Sequence:CCGGGCAGGACAAGAGATTTAAGAACTCGAGTTCTTAAATCTCTTGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002093.2-1087s1c1
Sequence:CCGGCCCAAACTACACAGAATTTAACTCGAGTTAAATTCTGTGTAGTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002093.2-404s1c1
Sequence:CCGGGACACTAAAGTGATTGGAAATCTCGAGATTTCCAATCACTTTAGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002093.2-924s1c1
Sequence:CCGGCCACTGATTATACCTCTAGTACTCGAGTACTAGAGGTATAATCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002093.x-1596s1c1
Sequence:CCGGCACTGGTCACGTTTGGAAAGACTCGAGTCTTTCCAAACGTGACCAGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002093.x-867s1c1
Sequence:CCGGCCAATGTTTCGTATATCTGTTCTCGAGAACAGATATACGAAACATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002093.x-562s1c1
Sequence:CCGGCCGATTGCGTTATTTCTTCTACTCGAGTAGAAGAAATAACGCAATCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002093.x-1306s1c1
Sequence:CCGGCCCAAATGTCAAACTACCAAACTCGAGTTTGGTAGTTTGACATTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002093.x-1017s1c1
Sequence:CCGGGTGTGGATCAGTTGGTAGAAACTCGAGTTTCTACCAACTGATCCACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002093
VALIDATED
GSK3B MISSION shRNA Lentiviral Transduction Particles
glycogen synthase kinase 3 beta
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002093.2-1292s1c1
Sequence:CCGGGATGAATTACGGGACCCAAATCTCGAGATTTGGGTCCCGTAATTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002093.2-974s1c1
Sequence:CCGGGCTGAGCTGTTACTAGGACAACTCGAGTTGTCCTAGTAACAGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002093.2-496s1c1
Sequence:CCGGGCAGGACAAGAGATTTAAGAACTCGAGTTCTTAAATCTCTTGTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002093.2-1087s1c1
Sequence:CCGGCCCAAACTACACAGAATTTAACTCGAGTTAAATTCTGTGTAGTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002093.2-404s1c1
Sequence:CCGGGACACTAAAGTGATTGGAAATCTCGAGATTTCCAATCACTTTAGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002093.2-924s1c1
Sequence:CCGGCCACTGATTATACCTCTAGTACTCGAGTACTAGAGGTATAATCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002093.x-1596s1c1
Sequence:CCGGCACTGGTCACGTTTGGAAAGACTCGAGTCTTTCCAAACGTGACCAGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002093.x-867s1c1
Sequence:CCGGCCAATGTTTCGTATATCTGTTCTCGAGAACAGATATACGAAACATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002093.x-562s1c1
Sequence:CCGGCCGATTGCGTTATTTCTTCTACTCGAGTAGAAGAAATAACGCAATCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002093.x-1306s1c1
Sequence:CCGGCCCAAATGTCAAACTACCAAACTCGAGTTTGGTAGTTTGACATTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002093.x-1017s1c1
Sequence:CCGGGTGTGGATCAGTTGGTAGAAACTCGAGTTTCTACCAACTGATCCACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)