EMAIL THIS PAGE TO A FRIEND

GSTA3

glutathione S-transferase alpha 3

Synonyms: GSTA3-3 GTA3
UniProtKB ID: Q16772, O43468, Q068V6, Q8WWA8, Q9H415
Gene ID:
Human(2940) Summary: Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. These enzymes are involved in cellular defense against toxic, carcinogenic, and pharmacologically active electrophilic compounds. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-tranferase belonging to the alpha class genes that are located in a cluster mapped to chromosome 6. Genes of the alpha class are highly related and encode enzymes with glutathione peroxidase activity. However, during evolution, this alpha class gene diverged accumulating mutations in the active site that resulted in differences in substrate specificity and catalytic activity. The enzyme encoded by this gene catalyzes the double bond isomerization of precursors for progesterone and testosterone during the biosynthesis of steroid hormones. An additional transcript variant has been identified, but its full length sequence has not been determined. [provided by RefSeq, Jul 2008]
Mouse(14859) glutathione S-transferase, alpha 3
Rat(24421) glutathione S-transferase A3
chicken(414896) glutathione S-transferase alpha 3
chicken(395612) glutathione S-transferase alpha 3
cow(768055) glutathione S-transferase, alpha 3
cow(777644) glutathione S-transferase alpha 3
dog(474938) glutathione S-transferase alpha 3
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Cell Lines

Product # Description Species Add to Cart
 
GS63 GST A3-3, Recombinant Human human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000847 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000847 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000847 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010356 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010356 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010356 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000847 Rosetta Predictions human pricing
NM_031509 Rosetta Predictions rat pricing
NM_001077353 Rosetta Predictions mouse pricing
NM_010356 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144749 predicted 399
2 SASI_Hs01_00144750 predicted 341
3 SASI_Hs01_00144751 predicted 541
4 SASI_Hs01_00144752 predicted 495
5 SASI_Hs02_00303353 predicted 358
6 SASI_Hs02_00303354 predicted 368
7 SASI_Hs02_00303355 predicted 371
8 SASI_Hs01_00144753 predicted 188
9 SASI_Hs01_00144754 predicted 846
10 SASI_Hs01_00144755 predicted 845
11 SASI_Hs01_00144756 predicted 717
12 SASI_Hs01_00144757 predicted 411
13 SASI_Hs01_00144758 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031509 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089097 predicted 898
2 SASI_Rn01_00089098 predicted 697
3 SASI_Rn01_00089099 predicted 365
4 SASI_Rn01_00089100 predicted 875
5 SASI_Rn01_00089101 predicted 869
6 SASI_Rn01_00089102 predicted 530
7 SASI_Rn01_00089103 predicted 753
8 SASI_Rn01_00089104 predicted 902
9 SASI_Rn01_00089105 predicted 364
10 SASI_Rn01_00089106 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077353 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292492 predicted 651
2 SASI_Mm02_00292493 predicted 395
3 SASI_Mm02_00292494 predicted 874
4 SASI_Mm02_00292495 predicted 1104
5 SASI_Mm02_00292496 predicted 1108
6 SASI_Mm02_00292497 predicted 924
7 SASI_Mm02_00292498 predicted 1128
8 SASI_Mm02_00292499 predicted 557
9 SASI_Mm02_00292500 predicted 1121
10 SASI_Mm02_00292501 predicted 1132
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010356 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041983 predicted 555
2 SASI_Mm01_00041984 predicted 299
3 SASI_Mm02_00318383 predicted 782
4 SASI_Mm02_00318384 predicted 1014
5 SASI_Mm02_00318385 predicted 1007
6 SASI_Mm02_00318386 predicted 827
7 SASI_Mm02_00318387 predicted 1038
8 SASI_Mm02_00318388 predicted 464
9 SASI_Mm02_00318389 predicted 1031
10 SASI_Mm02_00318390 predicted 1039
11 SASI_Mm01_00041985 predicted 350
12 SASI_Mm01_00041986 predicted 386
13 SASI_Mm01_00041987 predicted 224
14 SASI_Mm01_00041988 predicted 215
15 SASI_Mm01_00041989 predicted 749
16 SASI_Mm01_00041990 predicted 225
17 SASI_Mm01_00041991 predicted 657
18 SASI_Mm01_00041992 predicted 224
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000847
GSTA3 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase alpha 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000847.3-765s1c1
Sequence:CCGGGCTAAGAACATGCAAGACCAACTCGAGTTGGTCTTGCATGTTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000847.3-506s1c1
Sequence:CCGGCATGGACAAGACTACCTTGTTCTCGAGAACAAGGTAGTCTTGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000847.3-191s1c1
Sequence:CCGGGCAGAAGATTTGGGAAAGTTACTCGAGTAACTTTCCCAAATCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000847.3-367s1c1
Sequence:CCGGAGAAGGTATGGCAGATTTGAACTCGAGTTCAAATCTGCCATACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000847.3-372s1c1
Sequence:CCGGGTATGGCAGATTTGAATGAAACTCGAGTTTCATTCAAATCTGCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000847.4-548s21c1
Sequence:CCGGGACATTAGCCTGGTGGAACTTCTCGAGAAGTTCCACCAGGCTAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000847
GSTA3 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase alpha 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000847.3-765s1c1
Sequence:CCGGGCTAAGAACATGCAAGACCAACTCGAGTTGGTCTTGCATGTTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000847.3-506s1c1
Sequence:CCGGCATGGACAAGACTACCTTGTTCTCGAGAACAAGGTAGTCTTGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000847.3-191s1c1
Sequence:CCGGGCAGAAGATTTGGGAAAGTTACTCGAGTAACTTTCCCAAATCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000847.3-367s1c1
Sequence:CCGGAGAAGGTATGGCAGATTTGAACTCGAGTTCAAATCTGCCATACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000847.3-372s1c1
Sequence:CCGGGTATGGCAGATTTGAATGAAACTCGAGTTTCATTCAAATCTGCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000847.4-548s21c1
Sequence:CCGGGACATTAGCCTGGTGGAACTTCTCGAGAAGTTCCACCAGGCTAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000847
GSTA3 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase alpha 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000847.3-765s1c1
Sequence:CCGGGCTAAGAACATGCAAGACCAACTCGAGTTGGTCTTGCATGTTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000847.3-506s1c1
Sequence:CCGGCATGGACAAGACTACCTTGTTCTCGAGAACAAGGTAGTCTTGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000847.3-191s1c1
Sequence:CCGGGCAGAAGATTTGGGAAAGTTACTCGAGTAACTTTCCCAAATCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000847.3-367s1c1
Sequence:CCGGAGAAGGTATGGCAGATTTGAACTCGAGTTCAAATCTGCCATACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000847.3-372s1c1
Sequence:CCGGGTATGGCAGATTTGAATGAAACTCGAGTTTCATTCAAATCTGCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000847.4-548s21c1
Sequence:CCGGGACATTAGCCTGGTGGAACTTCTCGAGAAGTTCCACCAGGCTAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010356
GSTA3 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase alpha 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010356.2-837s1c1
Sequence:CCGGCCCTACTTAGAAAGCTAACAACTCGAGTTGTTAGCTTTCTAAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010356.2-206s1c1
Sequence:CCGGCTGGCAAGGTTACGAAGTGATCTCGAGATCACTTCGTAACCTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010356.2-512s1c1
Sequence:CCGGCATGGACAAGATTATCTCGTTCTCGAGAACGAGATAATCTTGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010356.2-389s1c1
Sequence:CCGGCTGGAGATAATGATTCTCTATCTCGAGATAGAGAATCATTATCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010356.2-311s1c1
Sequence:CCGGGCCTCCAAATACAACCTCTATCTCGAGATAGAGGTTGTATTTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010356
GSTA3 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase alpha 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010356.2-837s1c1
Sequence:CCGGCCCTACTTAGAAAGCTAACAACTCGAGTTGTTAGCTTTCTAAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010356.2-206s1c1
Sequence:CCGGCTGGCAAGGTTACGAAGTGATCTCGAGATCACTTCGTAACCTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010356.2-512s1c1
Sequence:CCGGCATGGACAAGATTATCTCGTTCTCGAGAACGAGATAATCTTGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010356.2-389s1c1
Sequence:CCGGCTGGAGATAATGATTCTCTATCTCGAGATAGAGAATCATTATCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010356.2-311s1c1
Sequence:CCGGGCCTCCAAATACAACCTCTATCTCGAGATAGAGGTTGTATTTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010356
GSTA3 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase alpha 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010356.2-837s1c1
Sequence:CCGGCCCTACTTAGAAAGCTAACAACTCGAGTTGTTAGCTTTCTAAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010356.2-206s1c1
Sequence:CCGGCTGGCAAGGTTACGAAGTGATCTCGAGATCACTTCGTAACCTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010356.2-512s1c1
Sequence:CCGGCATGGACAAGATTATCTCGTTCTCGAGAACGAGATAATCTTGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010356.2-389s1c1
Sequence:CCGGCTGGAGATAATGATTCTCTATCTCGAGATAGAGAATCATTATCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010356.2-311s1c1
Sequence:CCGGGCCTCCAAATACAACCTCTATCTCGAGATAGAGGTTGTATTTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks