EMAIL THIS PAGE TO A FRIEND

GSTA5

glutathione S-transferase alpha 5

UniProtKB ID: Q7RTV2, Q5SZC2
Gene ID:
Human(221357) Summary: The glutathione S-transferases (GST; EC 2.5.1.18) catalyze the conjugation of reduced glutathiones and a variety of electrophiles, including many known carcinogens and mutagens. The cytosolic GSTs belong to a large superfamily, with members located on different chromosomes. For additional information on GSTs, see GSTA1 (MIM 138359).[supplied by OMIM, Sep 2008]
Rat(494499) glutathione S-transferase alpha 5
Rat(494500) glutathione S-transferase Yc2 subunit
cow(521685) glutathione S-transferase alpha 5
43 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Cell Lines

Product # Description Species Add to Cart
 
GS58 GST A5-5, Recombinant Human human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153699 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153699 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153699 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127531 MISSION® esiRNA esiRNA human GSTA5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153699 Rosetta Predictions human pricing
NM_001009920 Rosetta Predictions rat pricing
NM_001010921 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153699 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230738 predicted 425
2 SASI_Hs01_00230739 predicted 354
3 SASI_Hs01_00230740 predicted 361
4 SASI_Hs01_00230741 predicted 347
5 SASI_Hs01_00230742 predicted 349
6 SASI_Hs01_00230743 predicted 339
7 SASI_Hs01_00230744 predicted 363
8 SASI_Hs01_00230745 predicted 561
9 SASI_Hs01_00230746 predicted 301
10 SASI_Hs01_00230737 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009920 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106287 predicted 733
2 SASI_Rn01_00106288 predicted 378
3 SASI_Rn01_00106289 predicted 822
4 SASI_Rn01_00106290 predicted 213
5 SASI_Rn01_00106291 predicted 819
6 SASI_Rn01_00106292 predicted 213
7 SASI_Rn01_00106293 predicted 540
8 SASI_Rn01_00106294 predicted 201
9 SASI_Rn01_00106295 predicted 717
10 SASI_Rn01_00106296 predicted 199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010921 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040695 predicted 290
2 SASI_Rn01_00040696 predicted 295
3 SASI_Rn01_00040697 predicted 293
4 SASI_Rn01_00040698 predicted 295
5 SASI_Rn01_00040699 predicted 697
6 SASI_Rn01_00040700 predicted 749
7 SASI_Rn02_00199820 predicted 105
8 SASI_Rn01_00040701 predicted 754
9 SASI_Rn01_00040704 predicted 110
10 SASI_Rn01_00040702 predicted 109
11 SASI_Rn01_00040703 predicted 701
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153699
GSTA5 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase alpha 5
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153699.1-398s1c1
Sequence:CCGGCTCATATGTCAACCAGAGGAACTCGAGTTCCTCTGGTTGACATATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153699.1-229s1c1
Sequence:CCGGGCAAGTACCAATGGTTGAGATCTCGAGATCTCAACCATTGGTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153699.1-284s1c1
Sequence:CCGGCTTAACTACATTGCCAGCAAACTCGAGTTTGCTGGCAATGTAGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153699.1-341s1c1
Sequence:CCGGCTGATTGATATGTACACAGAACTCGAGTTCTGTGTACATATCAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153699.1-296s1c1
Sequence:CCGGGCCAGCAAATACAACCTTTATCTCGAGATAAAGGTTGTATTTGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153699.1-274s1c1
Sequence:CCGGCAGAGCCATTCTTAACTACATCTCGAGATGTAGTTAAGAATGGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153699.1-689s1c1
Sequence:CCGGCCCATGGATGAGAAATCTTTACTCGAGTAAAGATTTCTCATCCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153699.1-497s1c1
Sequence:CCGGCACAGACAAGACTACCTTGTTCTCGAGAACAAGGTAGTCTTGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153699.1-678s21c1
Sequence:CCGGAGAGAAAGCCTCCCATGGATGCTCGAGCATCCATGGGAGGCTTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153699.1-112s21c1
Sequence:CCGGCAGTATGGAGTCCATTCGGTGCTCGAGCACCGAATGGACTCCATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153699.1-352s21c1
Sequence:CCGGGTACACAGAAGGTATAGTAGACTCGAGTCTACTATACCTTCTGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153699
GSTA5 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase alpha 5
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153699.1-398s1c1
Sequence:CCGGCTCATATGTCAACCAGAGGAACTCGAGTTCCTCTGGTTGACATATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153699.1-229s1c1
Sequence:CCGGGCAAGTACCAATGGTTGAGATCTCGAGATCTCAACCATTGGTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153699.1-284s1c1
Sequence:CCGGCTTAACTACATTGCCAGCAAACTCGAGTTTGCTGGCAATGTAGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153699.1-341s1c1
Sequence:CCGGCTGATTGATATGTACACAGAACTCGAGTTCTGTGTACATATCAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153699.1-296s1c1
Sequence:CCGGGCCAGCAAATACAACCTTTATCTCGAGATAAAGGTTGTATTTGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153699.1-274s1c1
Sequence:CCGGCAGAGCCATTCTTAACTACATCTCGAGATGTAGTTAAGAATGGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153699.1-689s1c1
Sequence:CCGGCCCATGGATGAGAAATCTTTACTCGAGTAAAGATTTCTCATCCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153699.1-497s1c1
Sequence:CCGGCACAGACAAGACTACCTTGTTCTCGAGAACAAGGTAGTCTTGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153699.1-678s21c1
Sequence:CCGGAGAGAAAGCCTCCCATGGATGCTCGAGCATCCATGGGAGGCTTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153699.1-112s21c1
Sequence:CCGGCAGTATGGAGTCCATTCGGTGCTCGAGCACCGAATGGACTCCATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153699.1-352s21c1
Sequence:CCGGGTACACAGAAGGTATAGTAGACTCGAGTCTACTATACCTTCTGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153699
GSTA5 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase alpha 5
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153699.1-398s1c1
Sequence:CCGGCTCATATGTCAACCAGAGGAACTCGAGTTCCTCTGGTTGACATATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153699.1-229s1c1
Sequence:CCGGGCAAGTACCAATGGTTGAGATCTCGAGATCTCAACCATTGGTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153699.1-284s1c1
Sequence:CCGGCTTAACTACATTGCCAGCAAACTCGAGTTTGCTGGCAATGTAGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153699.1-341s1c1
Sequence:CCGGCTGATTGATATGTACACAGAACTCGAGTTCTGTGTACATATCAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153699.1-296s1c1
Sequence:CCGGGCCAGCAAATACAACCTTTATCTCGAGATAAAGGTTGTATTTGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153699.1-274s1c1
Sequence:CCGGCAGAGCCATTCTTAACTACATCTCGAGATGTAGTTAAGAATGGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153699.1-689s1c1
Sequence:CCGGCCCATGGATGAGAAATCTTTACTCGAGTAAAGATTTCTCATCCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153699.1-497s1c1
Sequence:CCGGCACAGACAAGACTACCTTGTTCTCGAGAACAAGGTAGTCTTGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153699.1-678s21c1
Sequence:CCGGAGAGAAAGCCTCCCATGGATGCTCGAGCATCCATGGGAGGCTTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153699.1-112s21c1
Sequence:CCGGCAGTATGGAGTCCATTCGGTGCTCGAGCACCGAATGGACTCCATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153699.1-352s21c1
Sequence:CCGGGTACACAGAAGGTATAGTAGACTCGAGTCTACTATACCTTCTGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks