EMAIL THIS PAGE TO A FRIEND

GSTCD

glutathione S-transferase, C-terminal domain containing

UniProtKB ID: Q8NEC7, A8K8J0, A8MVD3, H9KV97, Q9H8S3
Gene ID:
Mouse(67553) glutathione S-transferase, C-terminal domain containing
Rat(310855) glutathione S-transferase, C-terminal domain containing
Zebrafish(402871) glutathione S-transferase, C-terminal domain containing
domestic cat(101091938) glutathione S-transferase, C-terminal domain containing
cow(526205) glutathione S-transferase, C-terminal domain containing
Horse(100073040) glutathione S-transferase, C-terminal domain containing
dog(487890) glutathione S-transferase, C-terminal domain containing
chicken(422536) glutathione S-transferase, C-terminal domain containing
domestic guinea pig(100713637) glutathione S-transferase, C-terminal domain containing
naked mole-rat(101720642) glutathione S-transferase, C-terminal domain containing
sheep(101103813) glutathione S-transferase, C-terminal domain containing
Domestic Rabbit(100358280) glutathione S-transferase, C-terminal domain containing
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024751 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024751 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024751 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026231 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026231 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026231 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU135241 MISSION® esiRNA esiRNA human GSTCD (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031720 Rosetta Predictions human pricing
NM_024751 Rosetta Predictions human pricing
NM_001107725 Rosetta Predictions rat pricing
NM_026231 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307754 predicted 1064
2 SASI_Hs02_00307755 predicted 981
3 SASI_Hs02_00307756 predicted 1114
4 SASI_Hs02_00307757 predicted 1679
5 SASI_Hs02_00307758 predicted 1537
6 SASI_Hs02_00307759 predicted 1190
7 SASI_Hs02_00307760 predicted 1518
8 SASI_Hs02_00307761 predicted 1501
9 SASI_Hs02_00307762 predicted 1815
10 SASI_Hs02_00307763 predicted 1886
11 SASI_Hs01_00227419 predicted 775
12 SASI_Hs01_00227420 predicted 847
13 SASI_Hs01_00227421 predicted 670
14 SASI_Hs01_00227422 predicted 626
15 SASI_Hs01_00227423 predicted 831
16 SASI_Hs01_00227424 predicted 754
17 SASI_Hs01_00227425 predicted 703
18 SASI_Hs01_00227426 predicted 613
19 SASI_Hs01_00227427 predicted 592
20 SASI_Hs01_00227428 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024751 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357237 predicted 979
2 SASI_Hs02_00357238 predicted 909
3 SASI_Hs02_00357239 predicted 1033
4 SASI_Hs02_00357240 predicted 1605
5 SASI_Hs02_00357241 predicted 1462
6 SASI_Hs02_00357242 predicted 1114
7 SASI_Hs02_00357243 predicted 1442
8 SASI_Hs02_00357244 predicted 1430
9 SASI_Hs02_00357245 predicted 1737
10 SASI_Hs02_00357246 predicted 1805
11 SASI_Hs01_00034029 predicted 950
12 SASI_Hs01_00034030 predicted 1021
13 SASI_Hs01_00034031 predicted 857
14 SASI_Hs01_00034032 predicted 807
15 SASI_Hs01_00034033 predicted 1009
16 SASI_Hs01_00034034 predicted 942
17 SASI_Hs01_00034035 predicted 887
18 SASI_Hs01_00034036 predicted 801
19 SASI_Hs01_00034037 predicted 773
20 SASI_Hs01_00034038 predicted 833
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107725 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231655 predicted 1594
2 SASI_Rn02_00231656 predicted 1791
3 SASI_Rn02_00231657 predicted 285
4 SASI_Rn02_00231658 predicted 1687
5 SASI_Rn02_00231659 predicted 1168
6 SASI_Rn02_00231660 predicted 220
7 SASI_Rn02_00231661 predicted 1718
8 SASI_Rn02_00231662 predicted 1292
9 SASI_Rn02_00231663 predicted 1600
10 SASI_Rn02_00231664 predicted 1702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026231 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169803 predicted 1184
2 SASI_Mm01_00169804 predicted 1306
3 SASI_Mm01_00169806 predicted 1650
4 SASI_Mm01_00169807 predicted 1763
5 SASI_Mm01_00169808 predicted 463
6 SASI_Mm01_00169809 predicted 1668
7 SASI_Mm01_00169810 predicted 233
8 SASI_Mm02_00329908 predicted 434
9 SASI_Mm01_00169812 predicted 2088
10 SASI_Mm02_00329909 predicted 591
11 SASI_Mm01_00169805 predicted 1456
12 SASI_Mm01_00169811 predicted 1459
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024751
VALIDATED
GSTCD MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase, C-terminal domain containing
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024751.2-863s21c1
Sequence:CCGGCTTGCCCTGTATCCATCATTTCTCGAGAAATGATGGATACAGGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024751.2-1118s21c1
Sequence:CCGGACCAACCATGGCCAAGTTAATCTCGAGATTAACTTGGCCATGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024751.2-1383s21c1
Sequence:CCGGCCATCATGTCAGGTTACATTACTCGAGTAATGTAACCTGACATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024751.2-1816s21c1
Sequence:GTACCGGGATACTCCGTTCAAGTGATATCTCGAGATATCACTTGAACGGAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024751.2-3570s21c1
Sequence:CCGGTGATCATCACTATGGATTAAACTCGAGTTTAATCCATAGTGATGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024751.1-1294s1c1
Sequence:CCGGCCTCAACTGAACAGCATCCAACTCGAGTTGGATGCTGTTCAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024751.1-1295s1c1
Sequence:CCGGCTCAACTGAACAGCATCCAAACTCGAGTTTGGATGCTGTTCAGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158716    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024751.1-1694s1c1
Sequence:CCGGGCAAGATTGTGGTTTCAGAATCTCGAGATTCTGAAACCACAATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024751.1-567s1c1
Sequence:CCGGGCTGTTGTATTGAGACACATACTCGAGTATGTGTCTCAATACAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024751.1-1734s1c1
Sequence:CCGGCAAAGCTAACTTGTTTGTCTTCTCGAGAAGACAAACAAGTTAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024751.1-362s1c1
Sequence:CCGGGTTATCTTACTGTGACTGTAACTCGAGTTACAGTCACAGTAAGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024751.1-768s1c1
Sequence:CCGGCCTGTAGAAATACTACAGCTACTCGAGTAGCTGTAGTATTTCTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024751.1-1551s1c1
Sequence:CCGGGTGGTAACAAATCAGGCCAAACTCGAGTTTGGCCTGATTTGTTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024751
VALIDATED
GSTCD MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase, C-terminal domain containing
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024751.2-863s21c1
Sequence:CCGGCTTGCCCTGTATCCATCATTTCTCGAGAAATGATGGATACAGGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024751.2-1118s21c1
Sequence:CCGGACCAACCATGGCCAAGTTAATCTCGAGATTAACTTGGCCATGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024751.2-1383s21c1
Sequence:CCGGCCATCATGTCAGGTTACATTACTCGAGTAATGTAACCTGACATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024751.2-1816s21c1
Sequence:GTACCGGGATACTCCGTTCAAGTGATATCTCGAGATATCACTTGAACGGAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024751.2-3570s21c1
Sequence:CCGGTGATCATCACTATGGATTAAACTCGAGTTTAATCCATAGTGATGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024751.1-1294s1c1
Sequence:CCGGCCTCAACTGAACAGCATCCAACTCGAGTTGGATGCTGTTCAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024751.1-1295s1c1
Sequence:CCGGCTCAACTGAACAGCATCCAAACTCGAGTTTGGATGCTGTTCAGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158716    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024751.1-1694s1c1
Sequence:CCGGGCAAGATTGTGGTTTCAGAATCTCGAGATTCTGAAACCACAATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024751.1-567s1c1
Sequence:CCGGGCTGTTGTATTGAGACACATACTCGAGTATGTGTCTCAATACAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024751.1-1734s1c1
Sequence:CCGGCAAAGCTAACTTGTTTGTCTTCTCGAGAAGACAAACAAGTTAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024751.1-362s1c1
Sequence:CCGGGTTATCTTACTGTGACTGTAACTCGAGTTACAGTCACAGTAAGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024751.1-768s1c1
Sequence:CCGGCCTGTAGAAATACTACAGCTACTCGAGTAGCTGTAGTATTTCTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024751.1-1551s1c1
Sequence:CCGGGTGGTAACAAATCAGGCCAAACTCGAGTTTGGCCTGATTTGTTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024751
VALIDATED
GSTCD MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase, C-terminal domain containing
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024751.2-863s21c1
Sequence:CCGGCTTGCCCTGTATCCATCATTTCTCGAGAAATGATGGATACAGGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024751.2-1118s21c1
Sequence:CCGGACCAACCATGGCCAAGTTAATCTCGAGATTAACTTGGCCATGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024751.2-1383s21c1
Sequence:CCGGCCATCATGTCAGGTTACATTACTCGAGTAATGTAACCTGACATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024751.2-1816s21c1
Sequence:GTACCGGGATACTCCGTTCAAGTGATATCTCGAGATATCACTTGAACGGAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024751.2-3570s21c1
Sequence:CCGGTGATCATCACTATGGATTAAACTCGAGTTTAATCCATAGTGATGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024751.1-1294s1c1
Sequence:CCGGCCTCAACTGAACAGCATCCAACTCGAGTTGGATGCTGTTCAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024751.1-1295s1c1
Sequence:CCGGCTCAACTGAACAGCATCCAAACTCGAGTTTGGATGCTGTTCAGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158716    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024751.1-1694s1c1
Sequence:CCGGGCAAGATTGTGGTTTCAGAATCTCGAGATTCTGAAACCACAATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024751.1-567s1c1
Sequence:CCGGGCTGTTGTATTGAGACACATACTCGAGTATGTGTCTCAATACAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024751.1-1734s1c1
Sequence:CCGGCAAAGCTAACTTGTTTGTCTTCTCGAGAAGACAAACAAGTTAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024751.1-362s1c1
Sequence:CCGGGTTATCTTACTGTGACTGTAACTCGAGTTACAGTCACAGTAAGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024751.1-768s1c1
Sequence:CCGGCCTGTAGAAATACTACAGCTACTCGAGTAGCTGTAGTATTTCTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024751.1-1551s1c1
Sequence:CCGGGTGGTAACAAATCAGGCCAAACTCGAGTTTGGCCTGATTTGTTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026231
VALIDATED
GSTCD MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase, C-terminal domain containing
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026231.2-1583s1c1
Sequence:CCGGCCAGGTTACGTTAATAGAGAACTCGAGTTCTCTATTAACGTAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026231.2-1122s1c1
Sequence:CCGGCCACTACTAACCTCTTGGTATCTCGAGATACCAAGAGGTTAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026231.2-692s1c1
Sequence:CCGGCCCAACTATCCCTGAAGAAATCTCGAGATTTCTTCAGGGATAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026231.2-2356s1c1
Sequence:CCGGCCTGATGATGTCAGTGGAATACTCGAGTATTCCACTGACATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026231.2-1310s1c1
Sequence:CCGGACCGACTATGACCAAGTTGATCTCGAGATCAACTTGGTCATAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026231
VALIDATED
GSTCD MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase, C-terminal domain containing
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026231.2-1583s1c1
Sequence:CCGGCCAGGTTACGTTAATAGAGAACTCGAGTTCTCTATTAACGTAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026231.2-1122s1c1
Sequence:CCGGCCACTACTAACCTCTTGGTATCTCGAGATACCAAGAGGTTAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026231.2-692s1c1
Sequence:CCGGCCCAACTATCCCTGAAGAAATCTCGAGATTTCTTCAGGGATAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026231.2-2356s1c1
Sequence:CCGGCCTGATGATGTCAGTGGAATACTCGAGTATTCCACTGACATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026231.2-1310s1c1
Sequence:CCGGACCGACTATGACCAAGTTGATCTCGAGATCAACTTGGTCATAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026231
VALIDATED
GSTCD MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase, C-terminal domain containing
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026231.2-1583s1c1
Sequence:CCGGCCAGGTTACGTTAATAGAGAACTCGAGTTCTCTATTAACGTAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026231.2-1122s1c1
Sequence:CCGGCCACTACTAACCTCTTGGTATCTCGAGATACCAAGAGGTTAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026231.2-692s1c1
Sequence:CCGGCCCAACTATCCCTGAAGAAATCTCGAGATTTCTTCAGGGATAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026231.2-2356s1c1
Sequence:CCGGCCTGATGATGTCAGTGGAATACTCGAGTATTCCACTGACATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026231.2-1310s1c1
Sequence:CCGGACCGACTATGACCAAGTTGATCTCGAGATCAACTTGGTCATAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks