EMAIL THIS PAGE TO A FRIEND

GSTM1

glutathione S-transferase mu 1

Synonyms: GST1 GSTM1-1 GSTM1a-1a GSTM1b-1b GTH4 GTM1 H-B MU MU-1
UniProtKB ID: P09488, Q5GHG0, Q6FH88, Q8TC98, Q9UC96
Gene ID:
Human(2944) Summary: Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Null mutations of this class mu gene have been linked with an increase in a number of cancers, likely due to an increased susceptibility to environmental toxins and carcinogens. Multiple protein isoforms are encoded by transcript variants of this gene. [provided by RefSeq, Jul 2008]
Mouse(14862) glutathione S-transferase, mu 1
Rat(24423) glutathione S-transferase mu 1
cow(327709) glutathione S-transferase M1
cow(783879) glutathione S-transferase mu 1
domestic guinea pig(100731426) glutathione S-transferase mu 1
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV41769 Anti-GSTM1 antibody produced in rabbit affinity isolated antibody bovine, goat, mouse, human, horse, guinea pig, rabbit, sheep, canine, rat
western blot pricing
SAB2702073 Anti-GSTM1 antibody produced in rabbit rat, mouse
western blot pricing
HPA055972 Anti-GSTM1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA055973 Anti-GSTM1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2500497 Anti-GSTM1/GSTM2 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
HPA048652 Anti-GSTM5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
WH0002944M1 Monoclonal Anti-GSTM1 antibody produced in mouse clone 3B10, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB5300282 Monoclonal Anti-GSTM1 antibody produced in mouse clone 1H4A4, ascites fluid human, monkey
ELISA, flow cytometry, immunohistochemistry, western blot pricing
SAB5300283 Monoclonal Anti-GSTM1 antibody produced in mouse clone 1H4F2, ascites fluid human, rat
ELISA, flow cytometry, immunohistochemistry, western blot pricing

Cell Lines

Product # Description Species Add to Cart
 
GS65 GST M1-1, Recombinant Human human pricing

ELISA

Product # Description Species Add to Cart
 
RAB1496 Human GSTM1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000561 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000561 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000561 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010358 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010358 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010358 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU115801 MISSION® esiRNA esiRNA human GSTM1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000561 Rosetta Predictions human pricing
NM_146421 Rosetta Predictions human pricing
NM_017014 Rosetta Predictions rat pricing
NM_010358 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000561 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244220 predicted 395
2 SASI_Hs01_00244221 predicted 380
3 SASI_Hs01_00244222 predicted 394
4 SASI_Hs01_00244223 predicted 490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146421 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195203 predicted 800
2 SASI_Hs01_00195204 predicted 803
3 SASI_Hs01_00195205 predicted 826
4 SASI_Hs01_00195206 predicted 796
5 SASI_Hs01_00195207 predicted 805
6 SASI_Hs01_00195208 predicted 826
7 SASI_Hs01_00195209 predicted 358
8 SASI_Hs01_00195210 predicted 547
9 SASI_Hs01_00195211 predicted 393
10 SASI_Hs01_00195212 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017014 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056201 predicted 831
2 SASI_Rn01_00056202 predicted 355
3 SASI_Rn01_00056203 predicted 659
4 SASI_Rn01_00056204 predicted 363
5 SASI_Rn01_00056205 predicted 636
6 SASI_Rn02_00261177 predicted 313
7 SASI_Rn02_00261178 predicted 235
8 SASI_Rn01_00056206 predicted 667
9 SASI_Rn01_00056207 predicted 249
10 SASI_Rn01_00056208 predicted 633
11 SASI_Rn01_00056209 predicted 369
12 SASI_Rn01_00056210 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010358 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318395 predicted 468
2 SASI_Mm02_00318396 predicted 465
3 SASI_Mm01_00130802 predicted 531
4 SASI_Mm01_00130804 predicted 527
5 SASI_Mm01_00130807 predicted 307
6 SASI_Mm02_00318397 predicted 486
7 SASI_Mm02_00318398 predicted 537
8 SASI_Mm02_00318399 predicted 475
9 SASI_Mm01_00130801 predicted 796
10 SASI_Mm01_00130803 predicted 799
11 SASI_Mm01_00130800 predicted 254
12 SASI_Mm01_00130805 predicted 747
13 SASI_Mm01_00130806 predicted 865
14 SASI_Mm01_00130808 predicted 678
15 SASI_Mm01_00130809 predicted 662
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000561
GSTM1 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase mu 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000561.3-356s21c1
Sequence:CCGGAGAAGATTCGTGTGGACATTTCTCGAGAAATGTCCACACGAATCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000561.3-1018s21c1
Sequence:CCGGGTGGTTGTGTCTGCTTTAAAGCTCGAGCTTTAAAGCAGACACAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000561.2-666s1c1
Sequence:CCGGCCCAAGACCTGTGTTCTCAAACTCGAGTTTGAGAACACAGGTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000561.2-585s1c1
Sequence:CCGGCTTCCCAAATCTGAAGGACTTCTCGAGAAGTCCTTCAGATTTGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000561.2-811s1c1
Sequence:CCGGCGTTCCTTTCTCCTGTTTATTCTCGAGAATAAACAGGAGAAAGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000561.2-552s1c1
Sequence:CCGGCCACCGTATATTTGAGCCCAACTCGAGTTGGGCTCAAATATACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000561.2-360s1c1
Sequence:CCGGCCAGACCATGGACAACCATATCTCGAGATATGGTTGTCCATGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000561
GSTM1 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase mu 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000561.3-356s21c1
Sequence:CCGGAGAAGATTCGTGTGGACATTTCTCGAGAAATGTCCACACGAATCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000561.3-1018s21c1
Sequence:CCGGGTGGTTGTGTCTGCTTTAAAGCTCGAGCTTTAAAGCAGACACAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000561.2-666s1c1
Sequence:CCGGCCCAAGACCTGTGTTCTCAAACTCGAGTTTGAGAACACAGGTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000561.2-585s1c1
Sequence:CCGGCTTCCCAAATCTGAAGGACTTCTCGAGAAGTCCTTCAGATTTGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000561.2-811s1c1
Sequence:CCGGCGTTCCTTTCTCCTGTTTATTCTCGAGAATAAACAGGAGAAAGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000561.2-552s1c1
Sequence:CCGGCCACCGTATATTTGAGCCCAACTCGAGTTGGGCTCAAATATACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000561.2-360s1c1
Sequence:CCGGCCAGACCATGGACAACCATATCTCGAGATATGGTTGTCCATGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000561
GSTM1 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase mu 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000561.3-356s21c1
Sequence:CCGGAGAAGATTCGTGTGGACATTTCTCGAGAAATGTCCACACGAATCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000561.3-1018s21c1
Sequence:CCGGGTGGTTGTGTCTGCTTTAAAGCTCGAGCTTTAAAGCAGACACAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000561.2-666s1c1
Sequence:CCGGCCCAAGACCTGTGTTCTCAAACTCGAGTTTGAGAACACAGGTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000561.2-585s1c1
Sequence:CCGGCTTCCCAAATCTGAAGGACTTCTCGAGAAGTCCTTCAGATTTGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000561.2-811s1c1
Sequence:CCGGCGTTCCTTTCTCCTGTTTATTCTCGAGAATAAACAGGAGAAAGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000561.2-552s1c1
Sequence:CCGGCCACCGTATATTTGAGCCCAACTCGAGTTGGGCTCAAATATACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000561.2-360s1c1
Sequence:CCGGCCAGACCATGGACAACCATATCTCGAGATATGGTTGTCCATGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010358
VALIDATED
GSTM1 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase mu 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103240    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010358.3-1024s1c1
Sequence:CCGGCAAGTCCACACAGCCTTCATTCTCGAGAATGAAGGCTGTGTGGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010358.3-571s1c1
Sequence:CCGGGCCAGAGTTCTTGAAGACCATCTCGAGATGGTCTTCAAGAACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010358.3-331s1c1
Sequence:CCGGCCAGTGGCTGAATGAGAAGTTCTCGAGAACTTCTCATTCAGCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010358.3-440s1c1
Sequence:CCGGGCCCGAAAGCACCACCTGGATCTCGAGATCCAGGTGGTGCTTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010358.3-538s1c1
Sequence:CCGGGCTCTGTTACAACCCTGACTTCTCGAGAAGTCAGGGTTGTAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010358
VALIDATED
GSTM1 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase mu 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103240    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010358.3-1024s1c1
Sequence:CCGGCAAGTCCACACAGCCTTCATTCTCGAGAATGAAGGCTGTGTGGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010358.3-571s1c1
Sequence:CCGGGCCAGAGTTCTTGAAGACCATCTCGAGATGGTCTTCAAGAACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010358.3-331s1c1
Sequence:CCGGCCAGTGGCTGAATGAGAAGTTCTCGAGAACTTCTCATTCAGCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010358.3-440s1c1
Sequence:CCGGGCCCGAAAGCACCACCTGGATCTCGAGATCCAGGTGGTGCTTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010358.3-538s1c1
Sequence:CCGGGCTCTGTTACAACCCTGACTTCTCGAGAAGTCAGGGTTGTAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010358
VALIDATED
GSTM1 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase mu 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103240    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010358.3-1024s1c1
Sequence:CCGGCAAGTCCACACAGCCTTCATTCTCGAGAATGAAGGCTGTGTGGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010358.3-571s1c1
Sequence:CCGGGCCAGAGTTCTTGAAGACCATCTCGAGATGGTCTTCAAGAACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010358.3-331s1c1
Sequence:CCGGCCAGTGGCTGAATGAGAAGTTCTCGAGAACTTCTCATTCAGCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010358.3-440s1c1
Sequence:CCGGGCCCGAAAGCACCACCTGGATCTCGAGATCCAGGTGGTGCTTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010358.3-538s1c1
Sequence:CCGGGCTCTGTTACAACCCTGACTTCTCGAGAAGTCAGGGTTGTAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks