EMAIL THIS PAGE TO A FRIEND

GSTT2B

glutathione S-transferase theta 2B (gene/pseudogene)

Synonyms: GSTT2P
Species: Human GSTT2B(653689)
UniProtKB ID: P0CG30, O60665, P30712, Q6IPV7, Q9HD76
Gene ID:
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080843 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080843 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080843 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU108461 MISSION® esiRNA esiRNA human GSTT2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080843 Rosetta Predictions human pricing
XM_928923 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080843 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316109 predicted 638
2 SASI_Hs02_00316110 predicted 221
3 SASI_Hs02_00316111 predicted 354
4 SASI_Hs02_00316112 predicted 216
5 SASI_Hs02_00316113 predicted 674
6 SASI_Hs02_00316114 predicted 253
7 SASI_Hs02_00316115 predicted 216
8 SASI_Hs02_00316116 predicted 355
9 SASI_Hs02_00316117 predicted 527
10 SASI_Hs02_00316118 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251278 predicted 450
2 SASI_Hs01_00251279 predicted 637
3 SASI_Hs01_00251280 predicted 334
4 SASI_Hs01_00251281 predicted 963
5 SASI_Hs01_00251282 predicted 538
6 SASI_Hs01_00251283 predicted 811
7 SASI_Hs01_00251284 predicted 500
8 SASI_Hs01_00251285 predicted 641
9 SASI_Hs01_00251286 predicted 509
10 SASI_Hs01_00251287 predicted 514
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080843
GSTT2B MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase theta 2B (gene/pseudogene)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080843.2-810s21c1
Sequence:CCGGATTAGCAACAAGGATTCATTCCTCGAGGAATGAATCCTTGTTGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080843.2-367s21c1
Sequence:CCGGTCCGTGGCACCTTTGGTATACCTCGAGGTATACCAAAGGTGCCACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080843.2-142s21c1
Sequence:CCGGGCACCGTGGATTTGGTCAAAGCTCGAGCTTTGACCAAATCCACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080843.2-249s21c1
Sequence:CCGGAGCTCGGCCATCCTGATTTACCTCGAGGTAAATCAGGATGGCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080843.2-215s21c1
Sequence:CCGGGACGCTCAAGGATGGTGATTTCTCGAGAAATCACCATCCTTGAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080843
GSTT2B MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase theta 2B (gene/pseudogene)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080843.2-810s21c1
Sequence:CCGGATTAGCAACAAGGATTCATTCCTCGAGGAATGAATCCTTGTTGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080843.2-367s21c1
Sequence:CCGGTCCGTGGCACCTTTGGTATACCTCGAGGTATACCAAAGGTGCCACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080843.2-142s21c1
Sequence:CCGGGCACCGTGGATTTGGTCAAAGCTCGAGCTTTGACCAAATCCACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080843.2-249s21c1
Sequence:CCGGAGCTCGGCCATCCTGATTTACCTCGAGGTAAATCAGGATGGCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080843.2-215s21c1
Sequence:CCGGGACGCTCAAGGATGGTGATTTCTCGAGAAATCACCATCCTTGAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080843
GSTT2B MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase theta 2B (gene/pseudogene)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080843.2-810s21c1
Sequence:CCGGATTAGCAACAAGGATTCATTCCTCGAGGAATGAATCCTTGTTGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080843.2-367s21c1
Sequence:CCGGTCCGTGGCACCTTTGGTATACCTCGAGGTATACCAAAGGTGCCACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080843.2-142s21c1
Sequence:CCGGGCACCGTGGATTTGGTCAAAGCTCGAGCTTTGACCAAATCCACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080843.2-249s21c1
Sequence:CCGGAGCTCGGCCATCCTGATTTACCTCGAGGTAAATCAGGATGGCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080843.2-215s21c1
Sequence:CCGGGACGCTCAAGGATGGTGATTTCTCGAGAAATCACCATCCTTGAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks