EMAIL THIS PAGE TO A FRIEND

GTF2A1

general transcription factor IIA, 1, 19/37kDa

Synonyms: TF2A1 TFIIA TFIIA-42 TFIIAL
UniProtKB ID: P52655, Q3KNQ9
Gene ID:
Human(2957) Summary: Accurate transcription initiation on TATA-containing class II genes involves the ordered assembly of RNA polymerase II (POLR2A; MIM 180660) and several general initiation factors (summarized by DeJong and Roeder, 1993 [PubMed 8224848]
Mouse(83602) general transcription factor II A, 1
Rat(83830) general transcription factor IIA, 1
Zebrafish(323974) general transcription factor IIA, 1
cow(785612) general transcription factor IIA, 1, 19/37kDa
Horse(100059967) general transcription factor IIA, 1, 19/37kDa
domestic cat(101089945) general transcription factor IIA, 1, 19/37kDa
dog(613006) general transcription factor IIA, 1, 19/37kDa
chicken(423389) general transcription factor IIA, 1, 19/37kDa
domestic guinea pig(100729927) general transcription factor IIA, 1, 19/37kDa
naked mole-rat(101726447) general transcription factor IIA, 1, 19/37kDa
sheep(100568291) general transcription factor IIA, 1, 19/37kDa
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015859 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015859 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015859 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031391 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031391 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031391 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015859 Rosetta Predictions human pricing
NM_201595 Rosetta Predictions human pricing
NM_022208 Rosetta Predictions rat pricing
NM_031391 Rosetta Predictions mouse pricing
NM_175335 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015859 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208730 predicted 930
2 SASI_Hs01_00208732 predicted 958
3 SASI_Hs01_00208733 predicted 929
4 SASI_Hs01_00208734 predicted 928
5 SASI_Hs01_00208735 predicted 977
6 SASI_Hs01_00208736 predicted 1014
7 SASI_Hs01_00208737 predicted 971
8 SASI_Hs01_00208738 predicted 943
9 SASI_Hs02_00348443 predicted 1048
10 SASI_Hs02_00348444 predicted 926
11 SASI_Hs01_00208731 predicted 967
12 SASI_Hs01_00208739 predicted 968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201595 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152583 predicted 554
2 SASI_Hs01_00152585 predicted 583
3 SASI_Hs01_00152586 predicted 559
4 SASI_Hs01_00152587 predicted 547
5 SASI_Hs01_00152588 predicted 593
6 SASI_Hs01_00152589 predicted 635
7 SASI_Hs01_00152590 predicted 592
8 SASI_Hs01_00152591 predicted 568
9 SASI_Hs02_00373101 predicted 672
10 SASI_Hs02_00373102 predicted 554
11 SASI_Hs01_00152584 predicted 588
12 SASI_Hs01_00152592 predicted 592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022208 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038817 predicted 498
2 SASI_Rn01_00038818 predicted 581
3 SASI_Rn01_00038819 predicted 907
4 SASI_Rn02_00262964 predicted 530
5 SASI_Rn01_00038822 predicted 547
6 SASI_Rn01_00038823 predicted 645
7 SASI_Rn01_00038824 predicted 798
8 SASI_Rn01_00038825 predicted 806
9 SASI_Rn02_00262965 predicted 499
10 SASI_Rn02_00262966 predicted 801
11 SASI_Rn01_00038820 predicted 671
12 SASI_Rn01_00038821 predicted 603
13 SASI_Rn01_00038826 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031391 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026036 predicted 537
2 SASI_Mm01_00026034 predicted 605
3 SASI_Mm01_00026035 predicted 561
4 SASI_Mm02_00337138 predicted 558
5 SASI_Mm01_00026037 predicted 560
6 SASI_Mm01_00026038 predicted 523
7 SASI_Mm01_00026039 predicted 553
8 SASI_Mm01_00026040 predicted 555
9 SASI_Mm01_00026041 predicted 555
10 SASI_Mm01_00026042 predicted 609
11 SASI_Mm01_00026043 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175335 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162016 predicted 1492
2 SASI_Mm01_00162017 predicted 1647
3 SASI_Mm01_00162018 predicted 1500
4 SASI_Mm01_00162019 predicted 1207
5 SASI_Mm01_00162020 predicted 1469
6 SASI_Mm01_00162022 predicted 1480
7 SASI_Mm01_00162023 predicted 619
8 SASI_Mm01_00162024 predicted 1462
9 SASI_Mm01_00162025 predicted 1257
10 SASI_Mm02_00346130 predicted 1545
11 SASI_Mm01_00162021 predicted 1660
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015859
VALIDATED
GTF2A1 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIA, 1, 19/37kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020549    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015859.2-1570s1c1
Sequence:CCGGGCTTTTTTTCTTTTATAAATACTCGAGTATTTATAAAAGAAAAAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015859.2-778s1c1
Sequence:CCGGCCACAAGTTATTGTTCCAGATCTCGAGATCTGGAACAATAACTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015859.2-1231s1c1
Sequence:CCGGGCTCCATTGGTCTTACAAGTTCTCGAGAACTTGTAAGACCAATGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015859.2-1016s1c1
Sequence:CCGGGTGGAGTACAAGCTCCTGTTACTCGAGTAACAGGAGCTTGTACTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015859.2-1409s1c1
Sequence:CCGGAGGAACTCTTTGACACAGAAACTCGAGTTTCTGTGTCAAAGAGTTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015859.2-979s21c1
Sequence:CCGGGTTCTACAACAACAGGTTATACTCGAGTATAACCTGTTGTTGTAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015859.2-1485s21c1
Sequence:GTACCGGTCATCTCAAGGATGGCATTATCTCGAGATAATGCCATCCTTGAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015859.2-1439s21c1
Sequence:CCGGTATGCCAATATGATAAGATACCTCGAGGTATCTTATCATATTGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015859.2-936s21c1
Sequence:CCGGAGCCAATGGTGCCCAATATATCTCGAGATATATTGGGCACCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015859.2-769s21c1
Sequence:CCGGGCCACAGCACCACAAGTTATTCTCGAGAATAACTTGTGGTGCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015859
VALIDATED
GTF2A1 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIA, 1, 19/37kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020549    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015859.2-1570s1c1
Sequence:CCGGGCTTTTTTTCTTTTATAAATACTCGAGTATTTATAAAAGAAAAAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015859.2-778s1c1
Sequence:CCGGCCACAAGTTATTGTTCCAGATCTCGAGATCTGGAACAATAACTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015859.2-1231s1c1
Sequence:CCGGGCTCCATTGGTCTTACAAGTTCTCGAGAACTTGTAAGACCAATGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015859.2-1016s1c1
Sequence:CCGGGTGGAGTACAAGCTCCTGTTACTCGAGTAACAGGAGCTTGTACTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015859.2-1409s1c1
Sequence:CCGGAGGAACTCTTTGACACAGAAACTCGAGTTTCTGTGTCAAAGAGTTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015859.2-979s21c1
Sequence:CCGGGTTCTACAACAACAGGTTATACTCGAGTATAACCTGTTGTTGTAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015859.2-1485s21c1
Sequence:GTACCGGTCATCTCAAGGATGGCATTATCTCGAGATAATGCCATCCTTGAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015859.2-1439s21c1
Sequence:CCGGTATGCCAATATGATAAGATACCTCGAGGTATCTTATCATATTGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015859.2-936s21c1
Sequence:CCGGAGCCAATGGTGCCCAATATATCTCGAGATATATTGGGCACCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015859.2-769s21c1
Sequence:CCGGGCCACAGCACCACAAGTTATTCTCGAGAATAACTTGTGGTGCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015859
VALIDATED
GTF2A1 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIA, 1, 19/37kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020549    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015859.2-1570s1c1
Sequence:CCGGGCTTTTTTTCTTTTATAAATACTCGAGTATTTATAAAAGAAAAAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015859.2-778s1c1
Sequence:CCGGCCACAAGTTATTGTTCCAGATCTCGAGATCTGGAACAATAACTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015859.2-1231s1c1
Sequence:CCGGGCTCCATTGGTCTTACAAGTTCTCGAGAACTTGTAAGACCAATGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015859.2-1016s1c1
Sequence:CCGGGTGGAGTACAAGCTCCTGTTACTCGAGTAACAGGAGCTTGTACTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015859.2-1409s1c1
Sequence:CCGGAGGAACTCTTTGACACAGAAACTCGAGTTTCTGTGTCAAAGAGTTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015859.2-979s21c1
Sequence:CCGGGTTCTACAACAACAGGTTATACTCGAGTATAACCTGTTGTTGTAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015859.2-1485s21c1
Sequence:GTACCGGTCATCTCAAGGATGGCATTATCTCGAGATAATGCCATCCTTGAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015859.2-1439s21c1
Sequence:CCGGTATGCCAATATGATAAGATACCTCGAGGTATCTTATCATATTGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015859.2-936s21c1
Sequence:CCGGAGCCAATGGTGCCCAATATATCTCGAGATATATTGGGCACCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015859.2-769s21c1
Sequence:CCGGGCCACAGCACCACAAGTTATTCTCGAGAATAACTTGTGGTGCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031391
VALIDATED
GTF2A1 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIA, 1, 19/37kDa
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031391.1-475s1c1
Sequence:CCGGGTTCAACAGCTACTAACAAATCTCGAGATTTGTTAGTAGCTGTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031391.1-1000s1c1
Sequence:CCGGGAACTCTTTGACGCTGAGAATCTCGAGATTCTCAGCGTCAAAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031391.1-469s1c1
Sequence:CCGGACTCCGGTTCAACAGCTACTACTCGAGTAGTAGCTGTTGAACCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_031391.1-470s1c1
Sequence:CCGGCTCCGGTTCAACAGCTACTAACTCGAGTTAGTAGCTGTTGAACCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031391.1-106s1c1
Sequence:CCGGGATGACGGAGTGGATGAACAACTCGAGTTGTTCATCCACTCCGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031391.2-351s21c1
Sequence:CCGGAGCAAGCGCAACCTCAGCAAACTCGAGTTTGCTGAGGTTGCGCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031391.2-1093s21c1
Sequence:CCGGTGTCGTCTGCCAGTATGATAACTCGAGTTATCATACTGGCAGACGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031391
VALIDATED
GTF2A1 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIA, 1, 19/37kDa
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031391.1-475s1c1
Sequence:CCGGGTTCAACAGCTACTAACAAATCTCGAGATTTGTTAGTAGCTGTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031391.1-1000s1c1
Sequence:CCGGGAACTCTTTGACGCTGAGAATCTCGAGATTCTCAGCGTCAAAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031391.1-469s1c1
Sequence:CCGGACTCCGGTTCAACAGCTACTACTCGAGTAGTAGCTGTTGAACCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_031391.1-470s1c1
Sequence:CCGGCTCCGGTTCAACAGCTACTAACTCGAGTTAGTAGCTGTTGAACCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031391.1-106s1c1
Sequence:CCGGGATGACGGAGTGGATGAACAACTCGAGTTGTTCATCCACTCCGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031391.2-351s21c1
Sequence:CCGGAGCAAGCGCAACCTCAGCAAACTCGAGTTTGCTGAGGTTGCGCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031391.2-1093s21c1
Sequence:CCGGTGTCGTCTGCCAGTATGATAACTCGAGTTATCATACTGGCAGACGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031391
VALIDATED
GTF2A1 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIA, 1, 19/37kDa
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031391.1-475s1c1
Sequence:CCGGGTTCAACAGCTACTAACAAATCTCGAGATTTGTTAGTAGCTGTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031391.1-1000s1c1
Sequence:CCGGGAACTCTTTGACGCTGAGAATCTCGAGATTCTCAGCGTCAAAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031391.1-469s1c1
Sequence:CCGGACTCCGGTTCAACAGCTACTACTCGAGTAGTAGCTGTTGAACCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_031391.1-470s1c1
Sequence:CCGGCTCCGGTTCAACAGCTACTAACTCGAGTTAGTAGCTGTTGAACCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031391.1-106s1c1
Sequence:CCGGGATGACGGAGTGGATGAACAACTCGAGTTGTTCATCCACTCCGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031391.2-351s21c1
Sequence:CCGGAGCAAGCGCAACCTCAGCAAACTCGAGTTTGCTGAGGTTGCGCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031391.2-1093s21c1
Sequence:CCGGTGTCGTCTGCCAGTATGATAACTCGAGTTATCATACTGGCAGACGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks