EMAIL THIS PAGE TO A FRIEND

GTSE1

G-2 and S-phase expressed 1

Synonyms: B99
Gene ID:
Human(51512) Summary: The protein encoded by this gene is only expressed in the S and G2 phases of the cell cycle, where it colocalizes with cytoplasmic tubulin and microtubules. In response to DNA damage, the encoded protein accumulates in the nucleus and binds the tumor suppressor protein p53, shuttling it out of the nucleus and repressing its ability to induce apoptosis. [provided by RefSeq, Jul 2008]
Mouse(29870) G two S phase expressed protein 1
Rat(300126) G-2 and S-phase expressed 1
chicken(425204) G-2 and S-phase expressed 1
dog(608855) G-2 and S-phase expressed 1
Horse(100053362) G-2 and S-phase expressed 1
domestic cat(101097327) G-2 and S-phase expressed 1
cow(507901) G-2 and S-phase expressed 1
sheep(101110583) G-2 and S-phase expressed 1
domestic guinea pig(100725251) G-2 and S-phase expressed 1
naked mole-rat(101722984) G-2 and S-phase expressed 1
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013882 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013882 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013882 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016426 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016426 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016426 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016426 Rosetta Predictions human pricing
NM_001130500 Rosetta Predictions rat pricing
NM_013882 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096054 predicted 228
2 SASI_Hs01_00096055 predicted 1414
3 SASI_Hs01_00096056 predicted 355
4 SASI_Hs01_00096057 predicted 436
5 SASI_Hs01_00096058 predicted 661
6 SASI_Hs01_00096059 predicted 1346
7 SASI_Hs01_00096061 predicted 1235
8 SASI_Hs01_00096062 predicted 212
9 SASI_Hs01_00096063 predicted 1347
10 SASI_Hs02_00349451 predicted 843
11 SASI_Hs01_00096060 predicted 1797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130500 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255429 predicted 963
2 SASI_Rn02_00255430 predicted 940
3 SASI_Rn02_00255431 predicted 1388
4 SASI_Rn02_00255432 predicted 2123
5 SASI_Rn02_00255433 predicted 370
6 SASI_Rn02_00255434 predicted 350
7 SASI_Rn02_00255435 predicted 1055
8 SASI_Rn02_00255436 predicted 1525
9 SASI_Rn02_00255437 predicted 221
10 SASI_Rn02_00255438 predicted 2124
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013882 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085064 predicted 992
2 SASI_Mm01_00085065 predicted 1422
3 SASI_Mm01_00085066 predicted 2416
4 SASI_Mm01_00085067 predicted 370
5 SASI_Mm01_00085068 predicted 354
6 SASI_Mm01_00085069 predicted 2153
7 SASI_Mm01_00085070 predicted 1098
8 SASI_Mm02_00322908 predicted 1559
9 SASI_Mm01_00085072 predicted 1213
10 SASI_Mm01_00085073 predicted 965
11 SASI_Mm01_00085071 predicted 1212
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013882
VALIDATED
GTSE1 MISSION shRNA Bacterial Glycerol Stock
G-2 and S-phase expressed 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013882.1-2171s21c1
Sequence:CCGGCATAATGAACACTCCAGACATCTCGAGATGTCTGGAGTGTTCATTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013882.1-2334s21c1
Sequence:CCGGCCTCTGCTGTTGATTCTGTTTCTCGAGAAACAGAATCAACAGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013882.1-1427s21c1
Sequence:CCGGTACCACAACAAACCCATTTAACTCGAGTTAAATGGGTTTGTTGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013882.1-205s21c1
Sequence:CCGGTTGGGCCTGTTGGACATAAAGCTCGAGCTTTATGTCCAACAGGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013882.1-1348s21c1
Sequence:CCGGCCGAGACACCTCAGTTGAATACTCGAGTATTCAACTGAGGTGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013882.1-2334s1c1
Sequence:CCGGCCTCTGCTGTTGATTCTGTTTCTCGAGAAACAGAATCAACAGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013882.1-1491s1c1
Sequence:CCGGCCAAAGTTCTCACGGACACATCTCGAGATGTGTCCGTGAGAACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013882.1-211s1c1
Sequence:CCGGCTGTTGGACATAAAGAAAGATCTCGAGATCTTTCTTTATGTCCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013882.1-2171s1c1
Sequence:CCGGCATAATGAACACTCCAGACATCTCGAGATGTCTGGAGTGTTCATTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013882.1-968s1c1
Sequence:CCGGGCTAAAGAAGACCCTGTTAAACTCGAGTTTAACAGGGTCTTCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013882
VALIDATED
GTSE1 MISSION shRNA shRNA Plasmid DNA
G-2 and S-phase expressed 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013882.1-2171s21c1
Sequence:CCGGCATAATGAACACTCCAGACATCTCGAGATGTCTGGAGTGTTCATTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013882.1-2334s21c1
Sequence:CCGGCCTCTGCTGTTGATTCTGTTTCTCGAGAAACAGAATCAACAGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013882.1-1427s21c1
Sequence:CCGGTACCACAACAAACCCATTTAACTCGAGTTAAATGGGTTTGTTGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013882.1-205s21c1
Sequence:CCGGTTGGGCCTGTTGGACATAAAGCTCGAGCTTTATGTCCAACAGGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013882.1-1348s21c1
Sequence:CCGGCCGAGACACCTCAGTTGAATACTCGAGTATTCAACTGAGGTGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013882.1-2334s1c1
Sequence:CCGGCCTCTGCTGTTGATTCTGTTTCTCGAGAAACAGAATCAACAGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013882.1-1491s1c1
Sequence:CCGGCCAAAGTTCTCACGGACACATCTCGAGATGTGTCCGTGAGAACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013882.1-211s1c1
Sequence:CCGGCTGTTGGACATAAAGAAAGATCTCGAGATCTTTCTTTATGTCCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013882.1-2171s1c1
Sequence:CCGGCATAATGAACACTCCAGACATCTCGAGATGTCTGGAGTGTTCATTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013882.1-968s1c1
Sequence:CCGGGCTAAAGAAGACCCTGTTAAACTCGAGTTTAACAGGGTCTTCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013882
VALIDATED
GTSE1 MISSION shRNA Lentiviral Transduction Particles
G-2 and S-phase expressed 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013882.1-2171s21c1
Sequence:CCGGCATAATGAACACTCCAGACATCTCGAGATGTCTGGAGTGTTCATTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013882.1-2334s21c1
Sequence:CCGGCCTCTGCTGTTGATTCTGTTTCTCGAGAAACAGAATCAACAGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013882.1-1427s21c1
Sequence:CCGGTACCACAACAAACCCATTTAACTCGAGTTAAATGGGTTTGTTGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013882.1-205s21c1
Sequence:CCGGTTGGGCCTGTTGGACATAAAGCTCGAGCTTTATGTCCAACAGGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013882.1-1348s21c1
Sequence:CCGGCCGAGACACCTCAGTTGAATACTCGAGTATTCAACTGAGGTGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013882.1-2334s1c1
Sequence:CCGGCCTCTGCTGTTGATTCTGTTTCTCGAGAAACAGAATCAACAGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013882.1-1491s1c1
Sequence:CCGGCCAAAGTTCTCACGGACACATCTCGAGATGTGTCCGTGAGAACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013882.1-211s1c1
Sequence:CCGGCTGTTGGACATAAAGAAAGATCTCGAGATCTTTCTTTATGTCCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013882.1-2171s1c1
Sequence:CCGGCATAATGAACACTCCAGACATCTCGAGATGTCTGGAGTGTTCATTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013882.1-968s1c1
Sequence:CCGGGCTAAAGAAGACCCTGTTAAACTCGAGTTTAACAGGGTCTTCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016426
VALIDATED
GTSE1 MISSION shRNA Bacterial Glycerol Stock
G-2 and S-phase expressed 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016426.5-3532s21c1
Sequence:CCGGGCCGCTACTTTGTGTCCATTTCTCGAGAAATGGACACAAAGTAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016426.5-1250s21c1
Sequence:CCGGGCCTCTGTCAAACATCAGCAACTCGAGTTGCTGATGTTTGACAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016426.5-354s21c1
Sequence:CCGGGCCAGCTTGGAATTAAATAATCTCGAGATTATTTAATTCCAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016426.5-1506s21c1
Sequence:CCGGCGGCGAGATTCCTGTCTAAATCTCGAGATTTAGACAGGAATCTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016426.5-1544s21c1
Sequence:CCGGGCCTACTCCTACAAATCAATTCTCGAGAATTGATTTGTAGGAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_016426.4-1427s1c1
Sequence:CCGGGCCTACTCCTACAAATCAATTCTCGAGAATTGATTTGTAGGAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113876    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016426.4-3415s1c1
Sequence:CCGGGCCGCTACTTTGTGTCCATTTCTCGAGAAATGGACACAAAGTAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016426.4-1133s1c1
Sequence:CCGGGCCTCTGTCAAACATCAGCAACTCGAGTTGCTGATGTTTGACAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016426.4-1389s1c1
Sequence:CCGGCGGCGAGATTCCTGTCTAAATCTCGAGATTTAGACAGGAATCTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_016426.4-237s1c1
Sequence:CCGGGCCAGCTTGGAATTAAATAATCTCGAGATTATTTAATTCCAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016426
VALIDATED
GTSE1 MISSION shRNA shRNA Plasmid DNA
G-2 and S-phase expressed 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016426.5-3532s21c1
Sequence:CCGGGCCGCTACTTTGTGTCCATTTCTCGAGAAATGGACACAAAGTAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016426.5-1250s21c1
Sequence:CCGGGCCTCTGTCAAACATCAGCAACTCGAGTTGCTGATGTTTGACAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016426.5-354s21c1
Sequence:CCGGGCCAGCTTGGAATTAAATAATCTCGAGATTATTTAATTCCAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016426.5-1506s21c1
Sequence:CCGGCGGCGAGATTCCTGTCTAAATCTCGAGATTTAGACAGGAATCTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016426.5-1544s21c1
Sequence:CCGGGCCTACTCCTACAAATCAATTCTCGAGAATTGATTTGTAGGAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_016426.4-1427s1c1
Sequence:CCGGGCCTACTCCTACAAATCAATTCTCGAGAATTGATTTGTAGGAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113876    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016426.4-3415s1c1
Sequence:CCGGGCCGCTACTTTGTGTCCATTTCTCGAGAAATGGACACAAAGTAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016426.4-1133s1c1
Sequence:CCGGGCCTCTGTCAAACATCAGCAACTCGAGTTGCTGATGTTTGACAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016426.4-1389s1c1
Sequence:CCGGCGGCGAGATTCCTGTCTAAATCTCGAGATTTAGACAGGAATCTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_016426.4-237s1c1
Sequence:CCGGGCCAGCTTGGAATTAAATAATCTCGAGATTATTTAATTCCAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016426
VALIDATED
GTSE1 MISSION shRNA Lentiviral Transduction Particles
G-2 and S-phase expressed 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016426.5-3532s21c1
Sequence:CCGGGCCGCTACTTTGTGTCCATTTCTCGAGAAATGGACACAAAGTAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016426.5-1250s21c1
Sequence:CCGGGCCTCTGTCAAACATCAGCAACTCGAGTTGCTGATGTTTGACAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016426.5-354s21c1
Sequence:CCGGGCCAGCTTGGAATTAAATAATCTCGAGATTATTTAATTCCAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016426.5-1506s21c1
Sequence:CCGGCGGCGAGATTCCTGTCTAAATCTCGAGATTTAGACAGGAATCTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016426.5-1544s21c1
Sequence:CCGGGCCTACTCCTACAAATCAATTCTCGAGAATTGATTTGTAGGAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_016426.4-1427s1c1
Sequence:CCGGGCCTACTCCTACAAATCAATTCTCGAGAATTGATTTGTAGGAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113876    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016426.4-3415s1c1
Sequence:CCGGGCCGCTACTTTGTGTCCATTTCTCGAGAAATGGACACAAAGTAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016426.4-1133s1c1
Sequence:CCGGGCCTCTGTCAAACATCAGCAACTCGAGTTGCTGATGTTTGACAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016426.4-1389s1c1
Sequence:CCGGCGGCGAGATTCCTGTCTAAATCTCGAGATTTAGACAGGAATCTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_016426.4-237s1c1
Sequence:CCGGGCCAGCTTGGAATTAAATAATCTCGAGATTATTTAATTCCAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks