EMAIL THIS PAGE TO A FRIEND

GUCA1A

guanylate cyclase activator 1A (retina)

Synonyms: C6orf131 COD3 CORD14 GCAP GCAP1 GUCA GUCA1 dJ139D8.6
UniProtKB ID: P43080, B3KWT4, Q7Z6T1, Q9NU14
Gene ID:
Human(2978) Summary: This gene plays a role in the recovery of retinal photoreceptors from photobleaching. In the recovery phase, the phototransduction messeneger cGMP is replenished by retinal guanylyl cyclase-1 (GC1). GC1 is activated by decreasing Ca(2+) concentrations following photobleaching. The protein encoded by this gene, guanylyl cyclase activating protein 1 (GCAP1), mediates the sensitivity of GC1 to Ca(2+) concentrations. GCAP1 promotes activity of GC1 at low Ca(2+) concentrations and inhibits GC1 activity at high Ca(2+) concentrations. Mutations in this gene cause autosomal dominant cone dystrophy (COD3); a disease characterized by reduced visual acuity associated with progressive loss of color vision. Mutations in this gene prohibit the inactivation of RetGC1 at high Ca(2+) concentrations; causing the constitutive activation of RetGC1 and, presumably, increased cell death. This gene is expressed in retina and spermatagonia. [provided by RefSeq, Feb 2009]
Mouse(14913) guanylate cyclase activator 1a (retina)
Rat(301233) guanylate cyclase activator 1a (retina)
Zebrafish(140430) guanylate cyclase activator 1A
chicken(374216) guanylate cyclase activator 1A (retina)
dog(609180) guanylate cyclase activator 1A (retina)
cow(282243) guanylate cyclase activator 1A (retina)
domestic cat(101080382) guanylate cyclase activator 1A (retina)
domestic guinea pig(100715154) guanylate cyclase activator 1A (retina)
naked mole-rat(101706235) guanylate cyclase activator 1A (retina)
sheep(101108346) guanylate cyclase activator 1A (retina)
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008189 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008189 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008189 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000409 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000409 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000409 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000409 Rosetta Predictions human pricing
NM_001106887 Rosetta Predictions rat pricing
NM_008189 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000409 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114636 predicted 733
2 SASI_Hs01_00114645 predicted 1278
3 SASI_Hs01_00114637 predicted 887
4 SASI_Hs01_00114638 predicted 812
5 SASI_Hs01_00114639 predicted 614
6 SASI_Hs01_00114640 predicted 1305
7 SASI_Hs01_00114641 predicted 720
8 SASI_Hs01_00114642 predicted 631
9 SASI_Hs01_00114644 predicted 1115
10 SASI_Hs02_00302502 predicted 891
11 SASI_Hs01_00114643 predicted 1272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106887 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223386 predicted 481
2 SASI_Rn02_00223387 predicted 382
3 SASI_Rn02_00223388 predicted 372
4 SASI_Rn02_00223389 predicted 376
5 SASI_Rn02_00223390 predicted 685
6 SASI_Rn02_00223391 predicted 463
7 SASI_Rn02_00223392 predicted 639
8 SASI_Rn02_00223393 predicted 280
9 SASI_Rn02_00223394 predicted 327
10 SASI_Rn02_00223395 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008189 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199105 predicted 558
2 SASI_Mm01_00199106 predicted 271
3 SASI_Mm01_00199107 predicted 279
4 SASI_Mm01_00199108 predicted 314
5 SASI_Mm01_00199109 predicted 367
6 SASI_Mm01_00199110 predicted 343
7 SASI_Mm01_00199111 predicted 519
8 SASI_Mm01_00199112 predicted 431
9 SASI_Mm01_00199113 predicted 439
10 SASI_Mm01_00199114 predicted 217
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008189
GUCA1A MISSION shRNA Bacterial Glycerol Stock
guanylate cyclase activator 1A (retina)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008189.2-441s1c1
Sequence:CCGGGCGCTGGTATTTCAAGCTCTACTCGAGTAGAGCTTGAAATACCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008189.2-213s1c1
Sequence:CCGGCGAGTGCCATCAGTGGTATAACTCGAGTTATACCACTGATGGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008189.2-561s1c1
Sequence:CCGGCGAGGAATTCACAGATACCGTCTCGAGACGGTATCTGTGAATTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008189.2-321s1c1
Sequence:CCGGCAGCCAGTATGTGGAACAGATCTCGAGATCTGTTCCACATACTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008189.2-323s1c1
Sequence:CCGGGCCAGTATGTGGAACAGATGTCTCGAGACATCTGTTCCACATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008189
GUCA1A MISSION shRNA shRNA Plasmid DNA
guanylate cyclase activator 1A (retina)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008189.2-441s1c1
Sequence:CCGGGCGCTGGTATTTCAAGCTCTACTCGAGTAGAGCTTGAAATACCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008189.2-213s1c1
Sequence:CCGGCGAGTGCCATCAGTGGTATAACTCGAGTTATACCACTGATGGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008189.2-561s1c1
Sequence:CCGGCGAGGAATTCACAGATACCGTCTCGAGACGGTATCTGTGAATTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008189.2-321s1c1
Sequence:CCGGCAGCCAGTATGTGGAACAGATCTCGAGATCTGTTCCACATACTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008189.2-323s1c1
Sequence:CCGGGCCAGTATGTGGAACAGATGTCTCGAGACATCTGTTCCACATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008189
GUCA1A MISSION shRNA Lentiviral Transduction Particles
guanylate cyclase activator 1A (retina)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008189.2-441s1c1
Sequence:CCGGGCGCTGGTATTTCAAGCTCTACTCGAGTAGAGCTTGAAATACCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008189.2-213s1c1
Sequence:CCGGCGAGTGCCATCAGTGGTATAACTCGAGTTATACCACTGATGGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008189.2-561s1c1
Sequence:CCGGCGAGGAATTCACAGATACCGTCTCGAGACGGTATCTGTGAATTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008189.2-321s1c1
Sequence:CCGGCAGCCAGTATGTGGAACAGATCTCGAGATCTGTTCCACATACTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008189.2-323s1c1
Sequence:CCGGGCCAGTATGTGGAACAGATGTCTCGAGACATCTGTTCCACATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000409
GUCA1A MISSION shRNA Bacterial Glycerol Stock
guanylate cyclase activator 1A (retina)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000409.2-892s1c1
Sequence:CCGGCGCTGGTACTTCAAGCTCTATCTCGAGATAGAGCTTGAAGTACCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000409.2-720s1c1
Sequence:CCGGCCTCTATGAGTTCCGCCAGTTCTCGAGAACTGGCGGAACTCATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000409.2-775s1c1
Sequence:CCGGCAGTACGTGGAACAGATGTTTCTCGAGAAACATCTGTTCCACGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000409.2-1023s1c1
Sequence:CCGGCGATACAGTGTTCTCCAAGATCTCGAGATCTTGGAGAACACTGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000409.2-963s1c1
Sequence:CCGGCCAGGCCATTCGCGCCATTAACTCGAGTTAATGGCGCGAATGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000409.3-1353s21c1
Sequence:CCGGAGGCTTAGCTCGCCTCTTTAGCTCGAGCTAAAGAGGCGAGCTAAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000409.3-1721s21c1
Sequence:CCCGCTACTTGTGCGCTTTGCATTTCTCGAGAAATGCAAAGCGCACAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000409.3-836s21c1
Sequence:CCGGACTTCAACAAGGACGGCTACACTCGAGTGTAGCCGTCCTTGTTGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000409
GUCA1A MISSION shRNA shRNA Plasmid DNA
guanylate cyclase activator 1A (retina)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000409.2-892s1c1
Sequence:CCGGCGCTGGTACTTCAAGCTCTATCTCGAGATAGAGCTTGAAGTACCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000409.2-720s1c1
Sequence:CCGGCCTCTATGAGTTCCGCCAGTTCTCGAGAACTGGCGGAACTCATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000409.2-775s1c1
Sequence:CCGGCAGTACGTGGAACAGATGTTTCTCGAGAAACATCTGTTCCACGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000409.2-1023s1c1
Sequence:CCGGCGATACAGTGTTCTCCAAGATCTCGAGATCTTGGAGAACACTGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000409.2-963s1c1
Sequence:CCGGCCAGGCCATTCGCGCCATTAACTCGAGTTAATGGCGCGAATGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000409.3-1353s21c1
Sequence:CCGGAGGCTTAGCTCGCCTCTTTAGCTCGAGCTAAAGAGGCGAGCTAAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000409.3-1721s21c1
Sequence:CCCGCTACTTGTGCGCTTTGCATTTCTCGAGAAATGCAAAGCGCACAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000409.3-836s21c1
Sequence:CCGGACTTCAACAAGGACGGCTACACTCGAGTGTAGCCGTCCTTGTTGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000409
GUCA1A MISSION shRNA Lentiviral Transduction Particles
guanylate cyclase activator 1A (retina)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000409.2-892s1c1
Sequence:CCGGCGCTGGTACTTCAAGCTCTATCTCGAGATAGAGCTTGAAGTACCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000409.2-720s1c1
Sequence:CCGGCCTCTATGAGTTCCGCCAGTTCTCGAGAACTGGCGGAACTCATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000409.2-775s1c1
Sequence:CCGGCAGTACGTGGAACAGATGTTTCTCGAGAAACATCTGTTCCACGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000409.2-1023s1c1
Sequence:CCGGCGATACAGTGTTCTCCAAGATCTCGAGATCTTGGAGAACACTGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000409.2-963s1c1
Sequence:CCGGCCAGGCCATTCGCGCCATTAACTCGAGTTAATGGCGCGAATGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000409.3-1353s21c1
Sequence:CCGGAGGCTTAGCTCGCCTCTTTAGCTCGAGCTAAAGAGGCGAGCTAAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000409.3-1721s21c1
Sequence:CCCGCTACTTGTGCGCTTTGCATTTCTCGAGAAATGCAAAGCGCACAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000409.3-836s21c1
Sequence:CCGGACTTCAACAAGGACGGCTACACTCGAGTGTAGCCGTCCTTGTTGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks