EMAIL THIS PAGE TO A FRIEND

GUCA2B

guanylate cyclase activator 2B (uroguanylin)

Synonyms: GCAP-II UGN
UniProtKB ID: Q16661, Q52LV0
Gene ID:
Human(2981) Summary: This gene encodes a member of the guanylin family, and is expressed in the stomach and intestine. This protein functions as an endogenous ligand for the guanylate cyclase-C receptor and stimulates an increase in cyclic GMP, a key component of several intracellular signal transduction pathways. It maybe involved in salt and water secretion into the intestinal lumen as well as the renal tubules, and thus regulate electrolyte homeostasis in these tissues. [provided by RefSeq, Oct 2011]
Mouse(14916) guanylate cyclase activator 2b (retina)
Rat(64055) guanylate cyclase activator 2B
domestic guinea pig(100135535) guanylate cyclase activator 2b (retina)
naked mole-rat(101720311) guanylate cyclase activator 2B (uroguanylin)
Zebrafish(325935) guanylate cyclase activator 2B (uroguanylin)
dog(100684829) guanylate cyclase activator 2B (uroguanylin)
cow(515664) guanylate cyclase activator 2B (uroguanylin)
domestic cat(101092381) guanylate cyclase activator 2B (uroguanylin)
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
K3375 Kynurenic acid ≥98% human, rat pricing

Proteins

Product # Description Species Add to Cart
 
U5131 Uroguanylin ≥90% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007102 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007102 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007102 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008191 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008191 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008191 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155471 MISSION® esiRNA esiRNA human GUCA2B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007102 Rosetta Predictions human pricing
NM_022284 Rosetta Predictions rat pricing
XM_579455 Rosetta Predictions rat pricing
NM_008191 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007102 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212491 predicted 295
2 SASI_Hs01_00212492 predicted 342
3 SASI_Hs01_00212493 predicted 318
4 SASI_Hs01_00212494 predicted 315
5 SASI_Hs01_00212495 predicted 269
6 SASI_Hs01_00212496 predicted 299
7 SASI_Hs01_00212497 predicted 275
8 SASI_Hs01_00212498 predicted 280
9 SASI_Hs01_00212499 predicted 329
10 SASI_Hs01_00212500 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022284 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263096 predicted 292
2 SASI_Rn01_00030456 predicted 297
3 SASI_Rn02_00263097 predicted 287
4 SASI_Rn02_00263098 predicted 239
5 SASI_Rn02_00263099 predicted 271
6 SASI_Rn02_00263100 predicted 277
7 SASI_Rn02_00263101 predicted 297
8 SASI_Rn01_00030460 predicted 290
9 SASI_Rn01_00030461 predicted 293
10 SASI_Rn02_00263102 predicted 289
11 SASI_Rn01_00030454 predicted 244
12 SASI_Rn01_00030455 predicted 271
13 SASI_Rn01_00030457 predicted 376
14 SASI_Rn01_00030458 predicted 414
15 SASI_Rn01_00030459 predicted 228
16 SASI_Rn01_00030462 predicted 226
17 SASI_Rn01_00030463 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579455 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00124159 predicted 320
2 SASI_Rn01_00124160 predicted 324
3 SASI_Rn01_00124161 predicted 267
4 SASI_Rn01_00124162 predicted 314
5 SASI_Rn01_00124163 predicted 267
6 SASI_Rn01_00124164 predicted 299
7 SASI_Rn01_00124165 predicted 301
8 SASI_Rn01_00124166 predicted 316
9 SASI_Rn01_00124167 predicted 316
10 SASI_Rn01_00124168 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008191 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110897 predicted 366
2 SASI_Mm01_00110899 predicted 289
3 SASI_Mm01_00110901 predicted 360
4 SASI_Mm02_00313333 predicted 379
5 SASI_Mm01_00110902 predicted 324
6 SASI_Mm01_00110903 predicted 365
7 SASI_Mm01_00110904 predicted 344
8 SASI_Mm01_00110905 predicted 259
9 SASI_Mm02_00313334 predicted 199
10 SASI_Mm01_00110906 predicted 356
11 SASI_Mm01_00110898 predicted 267
12 SASI_Mm01_00110900 predicted 309
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007102
GUCA2B MISSION shRNA Bacterial Glycerol Stock
guanylate cyclase activator 2B (uroguanylin)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007102.1-302s1c1
Sequence:CCGGCCTGAGGACCATCGCTAACGACTCGAGTCGTTAGCGATGGTCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007102.1-320s1c1
Sequence:CCGGCGACGACTGTGAGCTGTGTGTCTCGAGACACACAGCTCACAGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007102.1-95s1c1
Sequence:CCGGGAGCACACAGTCAGTCTACATCTCGAGATGTAGACTGACTGTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007102.2-289s21c1
Sequence:CCGGAGCATCTTCAAGACCCTGAGGCTCGAGCCTCAGGGTCTTGAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007102.2-337s21c1
Sequence:CCGGTGTGTGAACGTTGCGTGTACCCTCGAGGGTACACGCAACGTTCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007102.1-137s1c2
Sequence:CCGGCCAGCTGGAATCCATGAAGAACTCGAGTTCTTCATGGATTCCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007102.1-105s1c2
Sequence:CCGGTCAGTCTACATCCAGTACCAACTCGAGTTGGTACTGGATGTAGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007102.2-354s21c1
Sequence:CCGGTACCGGCTGCCTCTGAGATAGCTCGAGCTATCTCAGAGGCAGCCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007102.2-278s21c1
Sequence:CCGGAGGAGGCTTCCAGCATCTTCACTCGAGTGAAGATGCTGGAAGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007102
GUCA2B MISSION shRNA shRNA Plasmid DNA
guanylate cyclase activator 2B (uroguanylin)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007102.1-302s1c1
Sequence:CCGGCCTGAGGACCATCGCTAACGACTCGAGTCGTTAGCGATGGTCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007102.1-320s1c1
Sequence:CCGGCGACGACTGTGAGCTGTGTGTCTCGAGACACACAGCTCACAGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007102.1-95s1c1
Sequence:CCGGGAGCACACAGTCAGTCTACATCTCGAGATGTAGACTGACTGTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007102.2-289s21c1
Sequence:CCGGAGCATCTTCAAGACCCTGAGGCTCGAGCCTCAGGGTCTTGAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007102.2-337s21c1
Sequence:CCGGTGTGTGAACGTTGCGTGTACCCTCGAGGGTACACGCAACGTTCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007102.1-137s1c2
Sequence:CCGGCCAGCTGGAATCCATGAAGAACTCGAGTTCTTCATGGATTCCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007102.1-105s1c2
Sequence:CCGGTCAGTCTACATCCAGTACCAACTCGAGTTGGTACTGGATGTAGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007102.2-354s21c1
Sequence:CCGGTACCGGCTGCCTCTGAGATAGCTCGAGCTATCTCAGAGGCAGCCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007102.2-278s21c1
Sequence:CCGGAGGAGGCTTCCAGCATCTTCACTCGAGTGAAGATGCTGGAAGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007102
GUCA2B MISSION shRNA Lentiviral Transduction Particles
guanylate cyclase activator 2B (uroguanylin)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007102.1-302s1c1
Sequence:CCGGCCTGAGGACCATCGCTAACGACTCGAGTCGTTAGCGATGGTCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007102.1-320s1c1
Sequence:CCGGCGACGACTGTGAGCTGTGTGTCTCGAGACACACAGCTCACAGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007102.1-95s1c1
Sequence:CCGGGAGCACACAGTCAGTCTACATCTCGAGATGTAGACTGACTGTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007102.2-289s21c1
Sequence:CCGGAGCATCTTCAAGACCCTGAGGCTCGAGCCTCAGGGTCTTGAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007102.2-337s21c1
Sequence:CCGGTGTGTGAACGTTGCGTGTACCCTCGAGGGTACACGCAACGTTCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007102.1-137s1c2
Sequence:CCGGCCAGCTGGAATCCATGAAGAACTCGAGTTCTTCATGGATTCCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007102.1-105s1c2
Sequence:CCGGTCAGTCTACATCCAGTACCAACTCGAGTTGGTACTGGATGTAGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007102.2-354s21c1
Sequence:CCGGTACCGGCTGCCTCTGAGATAGCTCGAGCTATCTCAGAGGCAGCCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007102.2-278s21c1
Sequence:CCGGAGGAGGCTTCCAGCATCTTCACTCGAGTGAAGATGCTGGAAGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008191
GUCA2B MISSION shRNA Bacterial Glycerol Stock
guanylate cyclase activator 2B (uroguanylin)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008191.1-367s1c1
Sequence:CCGGCCGACGAATGTGAACTGTGTACTCGAGTACACAGTTCACATTCGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008191.1-206s1c1
Sequence:CCGGGCTGAATGAGTTGGAGGAGAACTCGAGTTCTCCTCCAACTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008191.1-369s1c1
Sequence:CCGGGACGAATGTGAACTGTGTATACTCGAGTATACACAGTTCACATTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008191.1-371s1c1
Sequence:CCGGCGAATGTGAACTGTGTATAAACTCGAGTTTATACACAGTTCACATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008191.1-382s1c1
Sequence:CCGGTGTGTATAAATGTTGCCTGTACTCGAGTACAGGCAACATTTATACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008191
GUCA2B MISSION shRNA shRNA Plasmid DNA
guanylate cyclase activator 2B (uroguanylin)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008191.1-367s1c1
Sequence:CCGGCCGACGAATGTGAACTGTGTACTCGAGTACACAGTTCACATTCGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008191.1-206s1c1
Sequence:CCGGGCTGAATGAGTTGGAGGAGAACTCGAGTTCTCCTCCAACTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008191.1-369s1c1
Sequence:CCGGGACGAATGTGAACTGTGTATACTCGAGTATACACAGTTCACATTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008191.1-371s1c1
Sequence:CCGGCGAATGTGAACTGTGTATAAACTCGAGTTTATACACAGTTCACATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008191.1-382s1c1
Sequence:CCGGTGTGTATAAATGTTGCCTGTACTCGAGTACAGGCAACATTTATACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008191
GUCA2B MISSION shRNA Lentiviral Transduction Particles
guanylate cyclase activator 2B (uroguanylin)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008191.1-367s1c1
Sequence:CCGGCCGACGAATGTGAACTGTGTACTCGAGTACACAGTTCACATTCGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008191.1-206s1c1
Sequence:CCGGGCTGAATGAGTTGGAGGAGAACTCGAGTTCTCCTCCAACTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008191.1-369s1c1
Sequence:CCGGGACGAATGTGAACTGTGTATACTCGAGTATACACAGTTCACATTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008191.1-371s1c1
Sequence:CCGGCGAATGTGAACTGTGTATAAACTCGAGTTTATACACAGTTCACATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008191.1-382s1c1
Sequence:CCGGTGTGTATAAATGTTGCCTGTACTCGAGTACAGGCAACATTTATACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks