EMAIL THIS PAGE TO A FRIEND

GUCY2C

guanylate cyclase 2C (heat stable enterotoxin receptor)

Synonyms: DIAR6 GUC2C MECIL MUCIL STAR
UniProtKB ID: P25092, B2RMY6
Gene ID:
Mouse(14917) guanylate cyclase 2c
Rat(25711) guanylate cyclase 2C
domestic guinea pig(100135536) guanylate cyclase 2c
naked mole-rat(101720874) guanylate cyclase 2C (heat stable enterotoxin receptor)
sheep(101108212) guanylate cyclase 2C (heat stable enterotoxin receptor)
chicken(417968) guanylate cyclase 2C (heat stable enterotoxin receptor)
cow(282244) guanylate cyclase 2C (heat stable enterotoxin receptor)
domestic cat(101095109) guanylate cyclase 2C (heat stable enterotoxin receptor)
dog(486671) guanylate cyclase 2C (heat stable enterotoxin receptor)
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100176 Anti-GUCY2C (981-995) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
GW22853 Anti-GUCY2C antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1411955 ANTI-GUCY2C antibody produced in mouse clone 3D2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411956 ANTI-GUCY2C antibody produced in mouse clone 2G7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411957 ANTI-GUCY2C antibody produced in mouse clone 3H3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412390 ANTI-GUCY2C antibody produced in mouse clone 2H8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412456 ANTI-GUCY2C antibody produced in mouse clone 3D5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412457 ANTI-GUCY2C antibody produced in mouse clone 3C2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412458 ANTI-GUCY2C antibody produced in mouse clone 3H6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412459 ANTI-GUCY2C antibody produced in mouse clone 1D11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412460 ANTI-GUCY2C antibody produced in mouse clone 1G5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412461 ANTI-GUCY2C antibody produced in mouse clone 3H1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412659 ANTI-GUCY2C antibody produced in mouse clone 1E1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA037655 Anti-GUCY2C antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
WH0002984M1 Monoclonal Anti-GUCY2C antibody produced in mouse clone 2F3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403898 Monoclonal Anti-GUCY2C antibody produced in mouse clone 1B11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_132928 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_132928 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_132928 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004963 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004963 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004963 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145067 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145067 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145067 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU190641 MISSION® esiRNA esiRNA targeting mouse Gucy2c mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004963 Rosetta Predictions human pricing
NM_013170 Rosetta Predictions rat pricing
XM_579377 Rosetta Predictions rat pricing
NM_001127318 Rosetta Predictions mouse pricing
NM_145067 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004963 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338651 predicted 2532
2 SASI_Hs01_00032829 predicted 2161
3 SASI_Hs01_00032830 predicted 536
4 SASI_Hs01_00032831 predicted 2789
5 SASI_Hs02_00338652 predicted 2494
6 SASI_Hs01_00032832 predicted 569
7 SASI_Hs01_00032833 predicted 2485
8 SASI_Hs01_00032834 predicted 2200
9 SASI_Hs01_00032835 predicted 1231
10 SASI_Hs01_00032836 predicted 708
11 SASI_Hs01_00032837 predicted 1827
12 SASI_Hs01_00032838 predicted 3279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013170 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075885 predicted 600
2 SASI_Rn01_00075886 predicted 995
3 SASI_Rn01_00075887 predicted 710
4 SASI_Rn02_00260993 predicted 1768
5 SASI_Rn01_00075888 predicted 1483
6 SASI_Rn01_00075889 predicted 3084
7 SASI_Rn01_00075890 predicted 328
8 SASI_Rn01_00075892 predicted 667
9 SASI_Rn01_00075893 predicted 1033
10 SASI_Rn01_00075894 predicted 734
11 SASI_Rn01_00075891 predicted 1807
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579377 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00165704 predicted 1386
2 SASI_Rn01_00165705 predicted 1465
3 SASI_Rn01_00165706 predicted 1383
4 SASI_Rn01_00165707 predicted 1256
5 SASI_Rn01_00165708 predicted 1186
6 SASI_Rn01_00165709 predicted 1481
7 SASI_Rn01_00165710 predicted 1286
8 SASI_Rn01_00165711 predicted 1456
9 SASI_Rn01_00165712 predicted 1397
10 SASI_Rn01_00165713 predicted 1147
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127318 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310217 predicted 2285
2 SASI_Mm02_00310218 predicted 1259
3 SASI_Mm02_00310219 predicted 550
4 SASI_Mm02_00310220 predicted 265
5 SASI_Mm02_00310221 predicted 3117
6 SASI_Mm02_00310222 predicted 3205
7 SASI_Mm02_00310223 predicted 855
8 SASI_Mm02_00310224 predicted 662
9 SASI_Mm02_00310225 predicted 628
10 SASI_Mm02_00310226 predicted 1304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145067 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118552 predicted 2210
2 SASI_Mm01_00118553 predicted 1258
3 SASI_Mm01_00118555 predicted 555
4 SASI_Mm01_00118556 predicted 269
5 SASI_Mm01_00118554 predicted 3046
6 SASI_Mm01_00118557 predicted 3138
7 SASI_Mm01_00118558 predicted 858
8 SASI_Mm01_00118559 predicted 655
9 SASI_Mm01_00118561 predicted 629
10 SASI_Mm02_00340491 predicted 1304
11 SASI_Mm01_00118560 predicted 1846
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_132928
GUCY2C MISSION shRNA Bacterial Glycerol Stock
guanylate cyclase 2C (heat stable enterotoxin receptor)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132928.3-1282s1c1
Sequence:CCGGCCAGGAAATACAAGGTTCTTACTCGAGTAAGAACCTTGTATTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132928.3-256s1c1
Sequence:CCGGCCTACAAAGAACCTATGCAAACTCGAGTTTGCATAGGTTCTTTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132928.3-3267s1c1
Sequence:CCGGGCCAGCTACAAGAAAGGCTTTCTCGAGAAAGCCTTTCTTGTAGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132928.3-676s1c1
Sequence:CCGGCCTGGAACTCTTCGTATGTTTCTCGAGAAACATACGAAGAGTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132928.3-1867s1c1
Sequence:CCGGCGTTCATGGATTGGGAGTTTACTCGAGTAAACTCCCAATCCATGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_132928
GUCY2C MISSION shRNA shRNA Plasmid DNA
guanylate cyclase 2C (heat stable enterotoxin receptor)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132928.3-1282s1c1
Sequence:CCGGCCAGGAAATACAAGGTTCTTACTCGAGTAAGAACCTTGTATTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132928.3-256s1c1
Sequence:CCGGCCTACAAAGAACCTATGCAAACTCGAGTTTGCATAGGTTCTTTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132928.3-3267s1c1
Sequence:CCGGGCCAGCTACAAGAAAGGCTTTCTCGAGAAAGCCTTTCTTGTAGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132928.3-676s1c1
Sequence:CCGGCCTGGAACTCTTCGTATGTTTCTCGAGAAACATACGAAGAGTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132928.3-1867s1c1
Sequence:CCGGCGTTCATGGATTGGGAGTTTACTCGAGTAAACTCCCAATCCATGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_132928
GUCY2C MISSION shRNA Lentiviral Transduction Particles
guanylate cyclase 2C (heat stable enterotoxin receptor)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132928.3-1282s1c1
Sequence:CCGGCCAGGAAATACAAGGTTCTTACTCGAGTAAGAACCTTGTATTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132928.3-256s1c1
Sequence:CCGGCCTACAAAGAACCTATGCAAACTCGAGTTTGCATAGGTTCTTTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132928.3-3267s1c1
Sequence:CCGGGCCAGCTACAAGAAAGGCTTTCTCGAGAAAGCCTTTCTTGTAGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132928.3-676s1c1
Sequence:CCGGCCTGGAACTCTTCGTATGTTTCTCGAGAAACATACGAAGAGTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132928.3-1867s1c1
Sequence:CCGGCGTTCATGGATTGGGAGTTTACTCGAGTAAACTCCCAATCCATGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004963
GUCY2C MISSION shRNA Bacterial Glycerol Stock
guanylate cyclase 2C (heat stable enterotoxin receptor)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004963.x-3280s1c1
Sequence:CCGGAGGTATAAGGACTCACACAAACTCGAGTTTGTGTGAGTCCTTATACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004963.x-1558s1c1
Sequence:CCGGCGACAGTGCAAATACGACAAACTCGAGTTTGTCGTATTTGCACTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004963.x-605s1c1
Sequence:CCGGCCTGGAGCACTTCGTATGTTTCTCGAGAAACATACGAAGTGCTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004963.x-3164s1c1
Sequence:CCGGCAGCAGGGATAAGAAGCCAAACTCGAGTTTGGCTTCTTATCCCTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004963.x-980s1c1
Sequence:CCGGCCAGGAATCTATCACCAACAACTCGAGTTGTTGGTGATAGATTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196972    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004963.1-3472s1c1
Sequence:CCGGGAACCTTATTCCAGCAGTTGTCTCGAGACAACTGCTGGAATAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004963.1-282s1c1
Sequence:CCGGGAACGCTACTTTCATGTATTCCTCGAGGAATACATGAAAGTAGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196592    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004963.1-3527s1c1
Sequence:CCGGGAATAGACTATCTAGAACTTGCTCGAGCAAGTTCTAGATAGTCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004963.1-1244s1c1
Sequence:CCGGCCCACGTAAATAAGACCTATCCTCGAGGATAGGTCTTATTTACGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004963.1-2425s1c1
Sequence:CCGGGCTGACAGACTTAACTTTATGCTCGAGCATAAAGTTAAGTCTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004963
GUCY2C MISSION shRNA shRNA Plasmid DNA
guanylate cyclase 2C (heat stable enterotoxin receptor)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004963.x-3280s1c1
Sequence:CCGGAGGTATAAGGACTCACACAAACTCGAGTTTGTGTGAGTCCTTATACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004963.x-1558s1c1
Sequence:CCGGCGACAGTGCAAATACGACAAACTCGAGTTTGTCGTATTTGCACTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004963.x-605s1c1
Sequence:CCGGCCTGGAGCACTTCGTATGTTTCTCGAGAAACATACGAAGTGCTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004963.x-3164s1c1
Sequence:CCGGCAGCAGGGATAAGAAGCCAAACTCGAGTTTGGCTTCTTATCCCTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004963.x-980s1c1
Sequence:CCGGCCAGGAATCTATCACCAACAACTCGAGTTGTTGGTGATAGATTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196972    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004963.1-3472s1c1
Sequence:CCGGGAACCTTATTCCAGCAGTTGTCTCGAGACAACTGCTGGAATAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004963.1-282s1c1
Sequence:CCGGGAACGCTACTTTCATGTATTCCTCGAGGAATACATGAAAGTAGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196592    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004963.1-3527s1c1
Sequence:CCGGGAATAGACTATCTAGAACTTGCTCGAGCAAGTTCTAGATAGTCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004963.1-1244s1c1
Sequence:CCGGCCCACGTAAATAAGACCTATCCTCGAGGATAGGTCTTATTTACGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004963.1-2425s1c1
Sequence:CCGGGCTGACAGACTTAACTTTATGCTCGAGCATAAAGTTAAGTCTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004963
GUCY2C MISSION shRNA Lentiviral Transduction Particles
guanylate cyclase 2C (heat stable enterotoxin receptor)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004963.x-3280s1c1
Sequence:CCGGAGGTATAAGGACTCACACAAACTCGAGTTTGTGTGAGTCCTTATACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004963.x-1558s1c1
Sequence:CCGGCGACAGTGCAAATACGACAAACTCGAGTTTGTCGTATTTGCACTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004963.x-605s1c1
Sequence:CCGGCCTGGAGCACTTCGTATGTTTCTCGAGAAACATACGAAGTGCTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004963.x-3164s1c1
Sequence:CCGGCAGCAGGGATAAGAAGCCAAACTCGAGTTTGGCTTCTTATCCCTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004963.x-980s1c1
Sequence:CCGGCCAGGAATCTATCACCAACAACTCGAGTTGTTGGTGATAGATTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196972    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004963.1-3472s1c1
Sequence:CCGGGAACCTTATTCCAGCAGTTGTCTCGAGACAACTGCTGGAATAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004963.1-282s1c1
Sequence:CCGGGAACGCTACTTTCATGTATTCCTCGAGGAATACATGAAAGTAGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196592    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004963.1-3527s1c1
Sequence:CCGGGAATAGACTATCTAGAACTTGCTCGAGCAAGTTCTAGATAGTCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004963.1-1244s1c1
Sequence:CCGGCCCACGTAAATAAGACCTATCCTCGAGGATAGGTCTTATTTACGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004963.1-2425s1c1
Sequence:CCGGGCTGACAGACTTAACTTTATGCTCGAGCATAAAGTTAAGTCTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145067
GUCY2C MISSION shRNA Bacterial Glycerol Stock
guanylate cyclase 2C (heat stable enterotoxin receptor)
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000360693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145067.3-341s21c1
Sequence:CCGGCTGCGTGAAGCCGACCTAAATCTCGAGATTTAGGTCGGCTTCACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145067.3-2721s21c1
Sequence:CCGGACCGACACGCGGTAGACATTTCTCGAGAAATGTCTACCGCGTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145067.3-388s21c1
Sequence:CCGGCTCCGACGGTCTGATTCATAACTCGAGTTATGAATCAGACCGTCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145067
GUCY2C MISSION shRNA shRNA Plasmid DNA
guanylate cyclase 2C (heat stable enterotoxin receptor)
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000360693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145067.3-341s21c1
Sequence:CCGGCTGCGTGAAGCCGACCTAAATCTCGAGATTTAGGTCGGCTTCACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145067.3-2721s21c1
Sequence:CCGGACCGACACGCGGTAGACATTTCTCGAGAAATGTCTACCGCGTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145067.3-388s21c1
Sequence:CCGGCTCCGACGGTCTGATTCATAACTCGAGTTATGAATCAGACCGTCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145067
GUCY2C MISSION shRNA Lentiviral Transduction Particles
guanylate cyclase 2C (heat stable enterotoxin receptor)
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000360693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145067.3-341s21c1
Sequence:CCGGCTGCGTGAAGCCGACCTAAATCTCGAGATTTAGGTCGGCTTCACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145067.3-2721s21c1
Sequence:CCGGACCGACACGCGGTAGACATTTCTCGAGAAATGTCTACCGCGTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145067.3-388s21c1
Sequence:CCGGCTCCGACGGTCTGATTCATAACTCGAGTTATGAATCAGACCGTCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks