EMAIL THIS PAGE TO A FRIEND

GUK1

guanylate kinase 1

Synonyms: GMK
UniProtKB ID: Q16774, B1ANH1
Gene ID:
Human(2987) Summary: The protein encoded by this gene is an enzyme that catalyzes the transfer of a phosphate group from ATP to guanosine monophosphate (GMP) to form guanosine diphosphate (GDP). The encoded protein is thought to be a good target for cancer chemotherapy. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Mouse(14923) guanylate kinase 1
Rat(303179) guanylate kinase 1
chicken(428399) guanylate kinase 1
domestic cat(101099523) guanylate kinase 1
cow(281217) guanylate kinase 1
dog(475178) guanylate kinase 1
domestic guinea pig(100733447) guanylate kinase 1
naked mole-rat(101718827) guanylate kinase 1
sheep(101122598) guanylate kinase 1
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000858 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000858 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000858 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008193 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008193 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008193 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000858 Rosetta Predictions human pricing
NM_001013115 Rosetta Predictions rat pricing
NM_008193 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000858 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164016 predicted 587
2 SASI_Hs01_00164017 predicted 421
3 SASI_Hs01_00164018 predicted 739
4 SASI_Hs01_00164019 predicted 381
5 SASI_Hs01_00164020 predicted 701
6 SASI_Hs01_00164021 predicted 581
7 SASI_Hs01_00164022 predicted 520
8 SASI_Hs01_00164023 predicted 419
9 SASI_Hs01_00164024 predicted 424
10 SASI_Hs01_00164025 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013115 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037738 predicted 305
2 SASI_Rn01_00037739 predicted 538
3 SASI_Rn01_00037740 predicted 618
4 SASI_Rn01_00037741 predicted 531
5 SASI_Rn01_00037742 predicted 299
6 SASI_Rn01_00037743 predicted 489
7 SASI_Rn01_00037744 predicted 628
8 SASI_Rn01_00037746 predicted 579
9 SASI_Rn01_00037747 predicted 487
10 SASI_Rn02_00200804 predicted 530
11 SASI_Rn01_00037745 predicted 361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008193 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032373 predicted 234
2 SASI_Mm01_00032375 predicted 685
3 SASI_Mm01_00032376 predicted 242
4 SASI_Mm01_00032377 predicted 279
5 SASI_Mm01_00032378 predicted 666
6 SASI_Mm01_00032379 predicted 656
7 SASI_Mm01_00032380 predicted 350
8 SASI_Mm01_00032381 predicted 547
9 SASI_Mm02_00313338 predicted 386
10 SASI_Mm01_00032382 predicted 315
11 SASI_Mm01_00032374 predicted 586
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000858
VALIDATED
GUK1 MISSION shRNA Bacterial Glycerol Stock
guanylate kinase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199606    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000858.4-948s1c1
Sequence:CCGGGCATGTGGAGTGGAGGAGATGCTCGAGCATCTCCTCCACTCCACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000858.4-404s1c1
Sequence:CCGGGATTACTACTTTGTAACCAGGCTCGAGCCTGGTTACAAAGTAGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000858.4-388s1c1
Sequence:CCGGCGAGGAGAACGGCAAAGATTACTCGAGTAATCTTTGCCGTTCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006116    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000858.3-811s1c1
Sequence:CCGGGCTTGCTGTCTGTTCTCGGCACTCGAGTGCCGAGAACAGACAGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000858.3-704s1c1
Sequence:CCGGCCTGTTTGATGTGGTCATCATCTCGAGATGATGACCACATCAAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000858.3-537s1c1
Sequence:CCGGCGGAACATCAAGGCCACCGATCTCGAGATCGGTGGCCTTGATGTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000858.3-320s1c1
Sequence:CCGGCGTGTCCCATACCACGAGGAACTCGAGTTCCTCGTGGTATGGGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000858.3-775s1c1
Sequence:CCGGAGGAAATCAAGAAAGCTCAAACTCGAGTTTGAGCTTTCTTGATTTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000858.4-426s1c1
Sequence:CCGGAGGTGATGCAGCGTGACATAGCTCGAGCTATGTCACGCTGCATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000858.4-459s1c1
Sequence:CCGGTCATCGAGCATGCCGAGTTCTCTCGAGAGAACTCGGCATGCTCGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000858
VALIDATED
GUK1 MISSION shRNA shRNA Plasmid DNA
guanylate kinase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199606    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000858.4-948s1c1
Sequence:CCGGGCATGTGGAGTGGAGGAGATGCTCGAGCATCTCCTCCACTCCACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000858.4-404s1c1
Sequence:CCGGGATTACTACTTTGTAACCAGGCTCGAGCCTGGTTACAAAGTAGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000858.4-388s1c1
Sequence:CCGGCGAGGAGAACGGCAAAGATTACTCGAGTAATCTTTGCCGTTCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006116    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000858.3-811s1c1
Sequence:CCGGGCTTGCTGTCTGTTCTCGGCACTCGAGTGCCGAGAACAGACAGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000858.3-704s1c1
Sequence:CCGGCCTGTTTGATGTGGTCATCATCTCGAGATGATGACCACATCAAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000858.3-537s1c1
Sequence:CCGGCGGAACATCAAGGCCACCGATCTCGAGATCGGTGGCCTTGATGTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000858.3-320s1c1
Sequence:CCGGCGTGTCCCATACCACGAGGAACTCGAGTTCCTCGTGGTATGGGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000858.3-775s1c1
Sequence:CCGGAGGAAATCAAGAAAGCTCAAACTCGAGTTTGAGCTTTCTTGATTTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000858.4-426s1c1
Sequence:CCGGAGGTGATGCAGCGTGACATAGCTCGAGCTATGTCACGCTGCATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000858.4-459s1c1
Sequence:CCGGTCATCGAGCATGCCGAGTTCTCTCGAGAGAACTCGGCATGCTCGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000858
VALIDATED
GUK1 MISSION shRNA Lentiviral Transduction Particles
guanylate kinase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199606    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000858.4-948s1c1
Sequence:CCGGGCATGTGGAGTGGAGGAGATGCTCGAGCATCTCCTCCACTCCACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000858.4-404s1c1
Sequence:CCGGGATTACTACTTTGTAACCAGGCTCGAGCCTGGTTACAAAGTAGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000858.4-388s1c1
Sequence:CCGGCGAGGAGAACGGCAAAGATTACTCGAGTAATCTTTGCCGTTCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006116    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000858.3-811s1c1
Sequence:CCGGGCTTGCTGTCTGTTCTCGGCACTCGAGTGCCGAGAACAGACAGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000858.3-704s1c1
Sequence:CCGGCCTGTTTGATGTGGTCATCATCTCGAGATGATGACCACATCAAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000858.3-537s1c1
Sequence:CCGGCGGAACATCAAGGCCACCGATCTCGAGATCGGTGGCCTTGATGTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000858.3-320s1c1
Sequence:CCGGCGTGTCCCATACCACGAGGAACTCGAGTTCCTCGTGGTATGGGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000858.3-775s1c1
Sequence:CCGGAGGAAATCAAGAAAGCTCAAACTCGAGTTTGAGCTTTCTTGATTTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000858.4-426s1c1
Sequence:CCGGAGGTGATGCAGCGTGACATAGCTCGAGCTATGTCACGCTGCATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000858.4-459s1c1
Sequence:CCGGTCATCGAGCATGCCGAGTTCTCTCGAGAGAACTCGGCATGCTCGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008193
GUK1 MISSION shRNA Bacterial Glycerol Stock
guanylate kinase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008193.2-213s1c1
Sequence:CCGGGATGGCAAAGATTACTACTTTCTCGAGAAAGTAGTAATCTTTGCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008193.2-582s1c1
Sequence:CCGGGACGACCTGGATAAAGCCTATCTCGAGATAGGCTTTATCCAGGTCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008193.2-243s1c1
Sequence:CCGGGAGATGATGCAGCGTGATATTCTCGAGAATATCACGCTGCATCATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008193.2-411s1c1
Sequence:CCGGCTGTGTCCCATCTACATCTTTCTCGAGAAAGATGTAGATGGGACACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008193.2-614s1c1
Sequence:CCGGGCAGGCGCTCTCTGAGGAAATCTCGAGATTTCCTCAGAGAGCGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008193.3-750s21c1
Sequence:CCGGGCAGGCGCTCTCTGAGGAAATCTCGAGATTTCCTCAGAGAGCGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008193.3-547s21c1
Sequence:CCGGCTGTGTCCCATCTACATCTTTCTCGAGAAAGATGTAGATGGGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008193.3-349s21c1
Sequence:CCGGGATGGCAAAGATTACTACTTTCTCGAGAAAGTAGTAATCTTTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008193.3-379s21c1
Sequence:CCGGGAGATGATGCAGCGTGATATTCTCGAGAATATCACGCTGCATCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008193
GUK1 MISSION shRNA shRNA Plasmid DNA
guanylate kinase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008193.2-213s1c1
Sequence:CCGGGATGGCAAAGATTACTACTTTCTCGAGAAAGTAGTAATCTTTGCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008193.2-582s1c1
Sequence:CCGGGACGACCTGGATAAAGCCTATCTCGAGATAGGCTTTATCCAGGTCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008193.2-243s1c1
Sequence:CCGGGAGATGATGCAGCGTGATATTCTCGAGAATATCACGCTGCATCATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008193.2-411s1c1
Sequence:CCGGCTGTGTCCCATCTACATCTTTCTCGAGAAAGATGTAGATGGGACACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008193.2-614s1c1
Sequence:CCGGGCAGGCGCTCTCTGAGGAAATCTCGAGATTTCCTCAGAGAGCGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008193.3-750s21c1
Sequence:CCGGGCAGGCGCTCTCTGAGGAAATCTCGAGATTTCCTCAGAGAGCGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008193.3-547s21c1
Sequence:CCGGCTGTGTCCCATCTACATCTTTCTCGAGAAAGATGTAGATGGGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008193.3-349s21c1
Sequence:CCGGGATGGCAAAGATTACTACTTTCTCGAGAAAGTAGTAATCTTTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008193.3-379s21c1
Sequence:CCGGGAGATGATGCAGCGTGATATTCTCGAGAATATCACGCTGCATCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008193
GUK1 MISSION shRNA Lentiviral Transduction Particles
guanylate kinase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008193.2-213s1c1
Sequence:CCGGGATGGCAAAGATTACTACTTTCTCGAGAAAGTAGTAATCTTTGCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008193.2-582s1c1
Sequence:CCGGGACGACCTGGATAAAGCCTATCTCGAGATAGGCTTTATCCAGGTCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008193.2-243s1c1
Sequence:CCGGGAGATGATGCAGCGTGATATTCTCGAGAATATCACGCTGCATCATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008193.2-411s1c1
Sequence:CCGGCTGTGTCCCATCTACATCTTTCTCGAGAAAGATGTAGATGGGACACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008193.2-614s1c1
Sequence:CCGGGCAGGCGCTCTCTGAGGAAATCTCGAGATTTCCTCAGAGAGCGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008193.3-750s21c1
Sequence:CCGGGCAGGCGCTCTCTGAGGAAATCTCGAGATTTCCTCAGAGAGCGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008193.3-547s21c1
Sequence:CCGGCTGTGTCCCATCTACATCTTTCTCGAGAAAGATGTAGATGGGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008193.3-349s21c1
Sequence:CCGGGATGGCAAAGATTACTACTTTCTCGAGAAAGTAGTAATCTTTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008193.3-379s21c1
Sequence:CCGGGAGATGATGCAGCGTGATATTCTCGAGAATATCACGCTGCATCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks