EMAIL THIS PAGE TO A FRIEND

H2BFWT

H2B histone family, member W, testis-specific

UniProtKB ID: Q7Z2G1, B1AK72, Q147W3
Gene ID:
Human(158983) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene encodes a member of the H2B histone family that is specifically expressed in sperm nuclei. A polymorphism in the 5' UTR of this gene is associated with male infertility.[provided by RefSeq, Jan 2010]
dog(491396) H2B histone family, member W, testis-specific
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002916 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002916 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002916 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002916 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122318 predicted 329
2 SASI_Hs02_00304265 predicted 253
3 SASI_Hs01_00122319 predicted 333
4 SASI_Hs01_00122320 predicted 514
5 SASI_Hs01_00122321 predicted 527
6 SASI_Hs01_00122322 predicted 471
7 SASI_Hs01_00122323 predicted 268
8 SASI_Hs01_00122324 predicted 495
9 SASI_Hs01_00122325 predicted 493
10 SASI_Hs01_00122326 predicted 688
11 SASI_Hs01_00122327 predicted 696
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002916
H2BFWT MISSION shRNA Bacterial Glycerol Stock
H2B histone family, member W, testis-specific
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002916.2-174s1c1
Sequence:CCGGCAACTCCACTACGTCCCAGAACTCGAGTTCTGGGACGTAGTGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002916.2-72s1c1
Sequence:CCGGTGTCTGGTCGTGCCATCTAATCTCGAGATTAGATGGCACGACCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002916.2-337s1c1
Sequence:CCGGGTCATGGATTCTTTGGTTCATCTCGAGATGAACCAAAGAATCCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002916.2-514s1c1
Sequence:CCGGAGAACTTCACTGTATGCCATACTCGAGTATGGCATACAGTGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002916.2-556s1c1
Sequence:CCGGCGCTGATACAAGAAGCAAGAACTCGAGTTCTTGCTTCTTGTATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002916
H2BFWT MISSION shRNA shRNA Plasmid DNA
H2B histone family, member W, testis-specific
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002916.2-174s1c1
Sequence:CCGGCAACTCCACTACGTCCCAGAACTCGAGTTCTGGGACGTAGTGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002916.2-72s1c1
Sequence:CCGGTGTCTGGTCGTGCCATCTAATCTCGAGATTAGATGGCACGACCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002916.2-337s1c1
Sequence:CCGGGTCATGGATTCTTTGGTTCATCTCGAGATGAACCAAAGAATCCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002916.2-514s1c1
Sequence:CCGGAGAACTTCACTGTATGCCATACTCGAGTATGGCATACAGTGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002916.2-556s1c1
Sequence:CCGGCGCTGATACAAGAAGCAAGAACTCGAGTTCTTGCTTCTTGTATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002916
H2BFWT MISSION shRNA Lentiviral Transduction Particles
H2B histone family, member W, testis-specific
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002916.2-174s1c1
Sequence:CCGGCAACTCCACTACGTCCCAGAACTCGAGTTCTGGGACGTAGTGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002916.2-72s1c1
Sequence:CCGGTGTCTGGTCGTGCCATCTAATCTCGAGATTAGATGGCACGACCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002916.2-337s1c1
Sequence:CCGGGTCATGGATTCTTTGGTTCATCTCGAGATGAACCAAAGAATCCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002916.2-514s1c1
Sequence:CCGGAGAACTTCACTGTATGCCATACTCGAGTATGGCATACAGTGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002916.2-556s1c1
Sequence:CCGGCGCTGATACAAGAAGCAAGAACTCGAGTTCTTGCTTCTTGTATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks