EMAIL THIS PAGE TO A FRIEND

H3F3A

H3 histone, family 3A

Synonyms: H3.3A H3F3
Gene ID:
Human(3020) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene contains introns and its mRNA is polyadenylated, unlike most histone genes. The protein encoded is a replication-independent member of the histone H3 family. [provided by RefSeq, Jul 2008]
Mouse(15078) H3 histone, family 3A
Rat(289314) H3 histone, family 3A
sheep(100135447) H3 histone, family 3A
domestic guinea pig(100735236) H3 histone, family 3A
Zebrafish(406269) H3 histone, family 3A
cow(326601) H3 histone, family 3A
domestic cat(100169960) H3 histone, family 3A
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
H9161 Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution bovine, frog, human, mouse, Drosophila, Caenorhabditis elegans, rat, chicken
immunofluorescence, microarray, western blot pricing
H9286 Anti-acetyl-Histone H3 (Ac-Lys9) antibody produced in rabbit 2-2.5 mg/mL, affinity isolated antibody, buffered aqueous solution Drosophila, human, bovine, chicken, frog, Caenorhabditis elegans, rat, mouse
immunofluorescence, microarray, western blot pricing
H0913 Anti-acetyl-Histone H3 (Ac-Lys9) antibody, Mouse monoclonal clone AH3-120, purified from hybridoma cell culture human, mouse, bovine, chicken, frog, rat, Drosophila, Caenorhabditis elegans
ELISA, immunocytochemistry, microarray, western blot pricing
D5692 Anti-dimethyl-Histone H3 (diMe-Lys4) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Caenorhabditis elegans, Arabidopsis thaliana, human, Drosophila, bovine, frog, rat, chicken, mouse
ChIP, microarray, western blot pricing
D5567 Anti-dimethyl-Histone H3 (diMe-Lys9) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Arabidopsis thaliana, Drosophila, Caenorhabditis elegans, human, bovine, chicken, frog, rat, mouse
ChIP, microarray, western blot pricing
SAB2701933 Anti-h3f3a antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry pricing
SAB2107597 Anti-H3F3A antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
HPA042570 Anti-H3F3A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
pricing
H0164 Anti-Histone H3 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, plant, human, rat, Drosophila, chicken, Xenopus
immunofluorescence, western blot pricing
SAB4501373 Anti-Histone H3.3, N-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, immunohistochemistry pricing
M4819 Anti-methyl-Histone H3 (Me-Lys4) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution chicken, Caenorhabditis elegans, mouse, bovine, Drosophila, human, frog, Arabidopsis thaliana, rat
western blot pricing
H7162 Anti-methyl-Histone H3 (Me-Lys9) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, Caenorhabditis elegans, rat, bovine, chicken, frog, human, Drosophila
microarray, western blot pricing
H0412 Anti-phospho-Histone H3 (pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse, frog, Drosophila, rat, Caenorhabditis elegans, bovine, chicken
immunofluorescence, microarray, western blot pricing
SAB4504092 Anti-phospho-Histone H3.3 (pSer31) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry pricing
SAB5100007 Imprint®ChIP-Validated Anti-Acetyl-Histone H3 (Ac-Lys9) (H3K9ac) antibody produced in rabbit affinity isolated antibody human
ChIP, western blot pricing
SAB5100009 Imprint ® ChiP-Validated Anti-methyl-Histone H3 (Me-Lys4) (H3K4me1) antibody produced in rabbit affinity isolated antibody chicken, frog, mouse, bovine, human
ChIP, western blot pricing
SAB5100008 Imprint® ChIP-Validated Anti-methyl-Histone H3 (Me-Lys9) (H3K9me1) affinity isolated antibody human
ChIP, western blot pricing
H0788 Monoclonal Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in mouse ~2 mg/mL, clone APH3-64, purified immunoglobulin, buffered aqueous solution frog, rat, Drosophila, Caenorhabditis elegans, human, mouse, bovine, chicken
ELISA, immunoprecipitation, microarray, western blot pricing
H9908 Monoclonal Anti-phospho-Histone H3 (pSer28) antibody produced in rat ~0.5 mg/mL, clone HTA28, purified immunoglobulin, buffered aqueous solution human, bovine, hamster, mouse
flow cytometry, immunocytochemistry, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002107 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002107 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002107 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008210 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008210 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008210 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127091 MISSION® esiRNA esiRNA targeting human H3F3A (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
12-359 Acetyl-Histone H3 (Lys14) Peptide 100 µg, Routinely evaluated by Dot Blot Assay. This peptide was recognized on a dot blot using Anti-acetyl Histone H3 (Lys14). The peptide was not recognized by anti-acetyl Histone H3 (Lys9) or anti-acetyl Histone H3 (Lys9,14). pricing
12-425 Acetyl-Histone H3 (Lys14) Peptide, biotin conjugate 100 µg, Routinely evaluated as a substrate for histone-modifying enzymes. pricing
12-360 Acetyl-Histone H3 (Lys9/14) Peptide 100 µg, Routinely evaluated by Dot Blot Assay. This peptide was spotted on nitrocellulose & detected by using polyclonal anti-acetylated Histone H3 (06-599). pricing
12-402 Acetyl-Histone H3 (Lys9/14) Peptide, biotin conjugate 100 µg, Synthetic peptide corresponding to amino acids 1-21 of human histone H3 followed by a GG linker & biotinylated lysine. pricing
12-358 Acetyl-Histone H3 (Lys9) Peptide 100 µg, Routinely evaluated in a Dot Blot Assay by spotting on nitrocellulose & detecting by using a Anti-acetyl Histone H3 (Lys9) (06-942). pricing
12-431 Acetyl-Histone H3 (Lys9) Peptide, biotin conjugate 100 µg, Routinely evaluated as a substrate for histone modifying enzymes. pricing
07-539 Anti-acetyl-Histone H3 (Lys 4) Antibody 100 µL, Anti-acetyl-Histone H3 (Lys 4) Antibody is a rabbit polyclonal antibody for detection of acetyl-Histone H3 (Lys 4) also known as H3K4Ac, Histone H3 (acetyl K4) & has been validated in Mplex, WB, PIA, ChIP, ChIP-seq, DB. pricing
07-540 Anti-acetyl-Histone H3 (Lys36) Antibody 100 µL, Use Anti-acetyl-Histone H3 (Lys36) Antibody (Rabbit Polyclonal Antibody) validated in WB, Mplex to detect acetyl-Histone H3 (Lys36) also known as H3K36Ac, Histone H3 (acetyl K36). pricing
07-750 Anti-acetyl-Histone H3 (Lys79) Antibody 100 µL, Anti-acetyl-Histone H3 (Lys79) Antibody is a Rabbit Polyclonal Antibody for detection of acetyl-Histone H3 (Lys79) also known as H3K79Ac, Histone H3 (acetyl K79) & has been validated in WB, ELISA. pricing
07-593 Anti-acetyl-Histone H3 (Lys9/18) Antibody 200 µL, Anti-acetyl-Histone H3 (Lys9/18) Antibody is a rabbit polyclonal antibody for detection of acetyl-Histone H3 (Lys9/18) also known as H3K9/18Ac, Histone H3 (acetyl K9/18) & has been validated in ChIP, WB, Mplex. pricing
04-077 Anti-dimethyl-Histone H3 (Arg17) Antibody, rabbit monoclonal 100 µL, Anti-dimethyl-Histone H3 (Arg17) Antibody, rabbit is an antibody against dimethyl-Histone H3 (Arg17) for use in WB. pricing
07-585 Anti-dimethyl-Histone H3 (Arg2) Antibody 200 µL, Anti-dimethyl-Histone H3 (Arg2) Antibody is a Rabbit Polyclonal Antibody for detection of dimethyl-Histone H3 (Arg2) also known as H3R2me2, Histone H3 (di methyl R2) & has been validated in WB, PIA. pricing
07-608 Anti-dimethyl Histone H3 (Lys23) Antibody 100 µL, Use Anti-dimethyl Histone H3 (Lys23) Antibody (Rabbit Polyclonal Antibody) validated in WB, DB, Mplex to detect dimethyl Histone H3 (Lys23) also known as H3K23me2, Histone H3 (di methyl K23). pricing
05-684 Anti-dimethyl-Histone H3 (Lys4) Antibody, clone RR302 400 µL, Use Anti-dimethyl-Histone H3 (Lys4) Antibody, clone RR302 (Mouse Monoclonal Antibody) validated in WB to detect dimethyl-Histone H3 (Lys4) also known as H3K4me2, Histone H3 (di methyl K4). pricing
04-835 Anti-dimethyl-Histone H3 (Lys79) Antibody, clone NL59, rabbit monoclonal 100 µL, Anti-dimethyl-Histone H3 (Lys79) Antibody, clone NL59 is a rabbit monoclonal antibody for detection of dimethyl-Histone H3 (Lys79) also known as H3K79me2, Histone H3 (di methyl K79) & has been validated in ChIP, WB, DB, Mplex. pricing
04-835-S Anti-dimethyl-Histone H3 (Lys79) Antibody, clone NL59, Trial Size, rabbit monoclonal 10 µL, Anti-dimethyl-Histone H3 (Lys79) Antibody, clone NL59 is a rabbit monoclonal antibody for detection of dimethyl-Histone H3 (Lys79) also known as H3K79me2, Histone H3 (di methyl K79) & has been validated in ChIP, WB, DB, Mplex. pricing
09-838 Anti-Histone H3.3 Antibody 100 µg, Use Anti-Histone H3.3 Antibody (Rabbit Polyclonal Antibody) validated in WB, ICC, DB, ChIP to detect Histone H3.3 also known as Histone H3.3. pricing
05-499 Anti-Histone H3 Antibody, clone 6.6.2 200 µg, Anti-Histone H3 Antibody, clone 6.6.2 is a Mouse Monoclonal Antibody for detection of Histone H3 also known as H3 histone family 3A & has been validated in WB. pricing
04-928 Anti-Histone H3 Antibody, CT, pan, clone A3S, rabbit monoclonal 100 µL, Anti-Histone H3 Antibody, CT, pan, clone A3S is a Rabbit Monoclonal Antibody for detection of Histone H3 also known as Histone H3 & has been validated in ChIP & WB. pricing
05-928 Anti-Histone H3 Antibody, CT, pan, clone A3S, rabbit monoclonal 100 µL, Use Anti-Histone H3 Antibody, CT, pan, clone A3S (Rabbit Monoclonal Antibody) validated in ChIP, WB to detect Histone H3 also known as Histone H3. pricing
05-1354 Anti-Histone H3 Antibody (Dimethyl K9, Phospho S10), clone 6HH3-2C5 100 µL, Use Anti-Histone H3 Antibody (Dimethyl K9, Phospho S10), clone 6HH3-2C5 (mouse monoclonal antibody) validated in WB, ICC to detect Histone H3 (Dimethyl K9 also known as H3K9me2S10P, Histone H3 (di methyl K9 phospho S10). pricing
ABE419 Anti-Histone H3 Antibody, K27M mutant 100 µg, Anti-Histone H3 Antibody, K27M mutant, is validated for use in western blotting (WB) & Chromatin immunoprecipitation (ChIP). pricing
07-548 Anti-monomethyl-Histone H3 (Lys36) Antibody 100 µL, Use Anti-monomethyl-Histone H3 (Lys36) Antibody (Rabbit Polyclonal Antibody) validated in DB, IF, WB, Mplex to detect monomethyl-Histone H3 (Lys36) also known as H3K36me1, Histone H3 (monomethyl K36). pricing
ABE153 Anti-phospho Histone H3.3 Antibody (Thr32) 100 µg, Detect Histone H3 using this rabbit polyclonal antibody, Anti-phospho Histone H3.3 Antibody (Thr32) validated for use in western blotting, IP & Dot Blot. pricing
07-679 Anti-phospho-Histone H3.3 (Ser31) Antibody 100 µL, Anti-phospho-Histone H3.3 (Ser31) Antibody is a Rabbit Polyclonal Antibody for detection of phospho-Histone H3.3 (Ser31) also known as H3S31P, Histone H3.3S31ph & has been tested in WB, PIA. pricing
MABE939 Anti-phospho Histone H3 (Ser10), clone 6G8B7 Antibody 100 µg, This Anti-phospho Histone H3 (Ser10), clone 6G8B7 Antibody is validated for use in Western Blotting and Immunocytochemistry and ELISA for the detection of phospho Histone H3 (Ser10). pricing
MABE76 Anti-phospho-Histone H3 (Ser28) Antibody, clone HTA28 100 µL, Anti-phospho-Histone H3 (Ser28) Antibody, clone HTA28 is a Rat Monoclonal Antibody for detection of phospho-Histone H3 (Ser28) also known as H3F3, H3F3B, H3S28P & has been validated in WB, DB, ICC. pricing
ABE152 Anti-phospho-Histone H3 (Ser31) Antibody 100 µg, Detect Histone H3 using this rabbit polyclonal antibody, Anti-phospho-Histone H3 (Ser31) Antibody validated for use in western blotting & Dot Blot. pricing
MABE940 Anti-phospho Histone H3 (Thr11) Antibody, clone 6G12C5 100 µg, This Anti-phospho Histone H3 (Thr11) Antibody, clone 6G12C5 is validated for use in western blotting, dot blot, ELISA & ICC for the detection of phospho Histone H3 (Thr11). pricing
07-549 Anti-trimethyl-Histone H3 (Lys36) Antibody 100 µL, Use Anti-trimethyl-Histone H3 (Lys36) Antibody (Rabbit Polyclonal Antibody) validated in DB, WB to detect trimethyl-Histone H3 (Lys36) also known as H3K36me3, Histone H3 (tri methyl K36). pricing
07-549-S Anti-trimethyl-Histone H3 (Lys36) Antibody, Trial Size 10 µL, Use Anti-trimethyl-Histone H3 (Lys36), Trial Size Antibody (Rabbit Polyclonal Antibody) validated in DB, WB to detect trimethyl-Histone H3 (Lys36) also known as H3K36me3, Histone H3 (tri methyl K36). pricing
05-745R Anti-trimethyl-Histone H3 (Lys4) Antibody, clone 15-10C-E4, rabbit monoclonal 100 µL, Use Anti-trimethyl-Histone H3 (Lys4) Antibody, clone 15-10C-E4, Recombinant (rabbit monoclonal antibody) proven in WB, ChIP, ChIP-seq, ELISA, PIA, Mplex, DB to detect trimethyl-Histone H3 (Lys4) also known as H3K4me3, Histone H3 (tri methyl K4). pricing
05-745R-S Anti-trimethyl-Histone H3 (Lys4) Antibody, clone 15-10C-E4, Trial Size 10 µL, Use Anti-trimethyl-Histone H3 (Lys4) Antibody, clone 15-10C-E4, Recombinant, Trial Size (rabbit monoclonal antibody) proven in WB, ChIP, ChIP-seq, ELISA, PIA, Mplex, DB to detect trimethyl-Histone H3 (Lys4) also known as H3K4me3. pricing
07-523 Anti-trimethyl-Histone H3 (Lys9) Antibody 200 µL, Anti-trimethyl-Histone H3 (Lys9) Antibody is a Rabbit Polyclonal Antibody for detection of trimethyl-Histone H3 (Lys9) also known as H3K9me3, Histone H3 (tri methyl K9) & has been validated in DB, PIA & WB. pricing
07-528 Anti-trimethyl (Lys79)-phospho (Thr80)-Histone H3 Antibody 100 µL, Use Anti-trimethyl (Lys79)-phospho (Thr80)-Histone H3 Antibody (rabbit polyclonal antibody) validated in WB, PIA, Mplex, DB to detect trimethyl (Lys79)-phospho (Thr80)-Histone H3 also known as H3K79me2T80P, Histone H3 (di methyl K79 phospho T80). pricing
17-10245 ChIPAb+™ Histone H3.3 - ChIP Validated Antibody and Primer Set 25 assays, This ChIPAb+ Histone H3.3 -ChIP Validated Antibody & Primer Set conveniently includes the antibody & the specific control PCR primers. pricing
17-622 ChIPAb+ Trimethyl-Histone H3 (Lys27) - ChIP Validated Antibody and Primer Set 25 assays, Trimethyl-Histone H3 (Lys27) ChIP validated antibody & primer set including the ChIP-grade antibody & the specific control PCR primers used for chromatin immunoprecipitation of H3K27Me3. pricing
17-614 ChIPAb+ Trimethyl-Histone H3 (Lys4) - ChIP Validated Antibody and Primer Set, rabbit monoclonal 25 assays, Trimethyl-Histone H3 (Lys4) ChIP validated antibody & primer set including the ChIP-grade antibody & the specific control PCR primers used for chromatin immunoprecipitation of H3K4Me3. pricing
17-625 ChIPAb+ Trimethyl-Histone H3 (Lys9) - ChIP Validated Antibody and Primer Set 25 assays, Trimethyl-Histone H3 (Lys9) ChIP validated antibody & primer set including the ChIP-grade antibody & the specific control PCR primers used for chromatin immunoprecipitation of H3K9Me3. pricing
12-566 Dimethyl-Histone H3 (Lys27) Peptide, biotin conjugate 100 µg, Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. pricing
12-460 Dimethyl-Histone H3 (Lys4) Peptide, biotin conjugate 100 µg, Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. pricing
12-430 Dimethyl-Histone H3 (Lys9) Peptide, biotin conjugate 100 µg, Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. pricing
14-494 Histone H3, human recombinant 100 µg, Recombinant human histone H3. pricing
12-357 Histone H3 Peptide 100 µg, This gene contains introns & its mRNA is polyadenylated, unlike most histone genes. The protein encoded is a replication-independent member of the histone H3 family. pricing
12-403 Histone H3 Peptide, biotin conjugate 100 µg, This peptide corresponds to residues 1-21 of histone H3. pricing
12-404 Histone H3 Peptide, biotin conjugate, residues 21-44 100 µg, This gene contains introns & its mRNA is polyadenylated, unlike most histone genes. The protein encoded is a replication-independent member of the histone H3 family. pricing
14-411 Histone H3, Recombinant Xenopus laevis 100 µg, Recombinant Xenopus laevis Histone H3. pricing
FCABS325PE Milli-Mark™ Anti-acetyl-Histone H3-PE Antibody 100 tests, This Milli-Mark Anti-acetyl-Histone H3-PE Antibody is validated for use in FC for the detection of acetyl-Histone H3. pricing
12-567 Monomethyl-Histone H3 (Lys27) Peptide, biotin conjugate 100 µg, Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. pricing
12-570 Monomethyl-Histone H3 (Lys36) Peptide, biotin conjugate 100 µg, Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. pricing
12-563 Monomethyl-Histone H3 (Lys4) Peptide, biotin conjugate 100 µg, Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. pricing
12-569 Monomethyl-Histone H3 (Lys9) Peptide, biotin conjugate 100 µg, Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. pricing
12-428 Phospho (Ser10)-acetyl (Lys9/14)-Histone H3 Peptide, biotin conjugate 100 µg, Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. pricing
12-427 Phospho (Ser10)-Histone H3 Peptide, biotin conjugate 100 µg, Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. pricing
12-565 Trimethyl-Histone H3 (Lys27) Peptide, biotin conjugate 100 µg, Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. pricing
12-564 Trimethyl-Histone H3 (Lys4) Peptide, biotin conjugate 100 µg, Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. pricing
12-568 Trimethyl-Histone H3 (Lys9) Peptide, biotin conjugate 100 µg, Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002107 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002107 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333221 predicted 138
2 SASI_Hs02_00333222 predicted 370
3 SASI_Hs01_00222708 predicted 1008
4 SASI_Hs01_00222709 predicted 883
5 SASI_Hs02_00333223 predicted 145
6 SASI_Hs01_00222706 predicted 145
7 SASI_Hs01_00222707 predicted 674
8 SASI_Hs01_00222710 predicted 643
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002107
H3F3A MISSION shRNA Bacterial Glycerol Stock
H3 histone, family 3A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002107.3-738s1c1
Sequence:CCGGGCGGAGACGTAAAGCATTAATCTCGAGATTAATGCTTTACGTCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002107.2-283s1c1
Sequence:CCGGGAAGTCCACTGAACTTCTGATCTCGAGATCAGAAGTTCAGTGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002107.2-301s1c1
Sequence:CCGGGATTCGCAAACTTCCCTTCCACTCGAGTGGAAGGGAAGTTTGCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002107.2-258s1c1
Sequence:CCGGCGCTCCGTGAAATTAGACGTTCTCGAGAACGTCTAATTTCACGGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002107.2-288s1c1
Sequence:CCGGCCACTGAACTTCTGATTCGCACTCGAGTGCGAATCAGAAGTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002107.2-166s1c1
Sequence:CCGGCAGGAAGCAACTGGCTACAAACTCGAGTTTGTAGCCAGTTGCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002107.2-293s1c1
Sequence:CCGGGAACTTCTGATTCGCAAACTTCTCGAGAAGTTTGCGAATCAGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144286    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002107.3-531s1c1
Sequence:CCGGCCACTATGATGGGAAACATTTCTCGAGAAATGTTTCCCATCATAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002107.3-886s1c1
Sequence:CCGGGATGGCAACTAAATGGTGTTTCTCGAGAAACACCATTTAGTTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002107
H3F3A MISSION shRNA shRNA Plasmid DNA
H3 histone, family 3A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002107.3-738s1c1
Sequence:CCGGGCGGAGACGTAAAGCATTAATCTCGAGATTAATGCTTTACGTCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002107.2-283s1c1
Sequence:CCGGGAAGTCCACTGAACTTCTGATCTCGAGATCAGAAGTTCAGTGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002107.2-301s1c1
Sequence:CCGGGATTCGCAAACTTCCCTTCCACTCGAGTGGAAGGGAAGTTTGCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002107.2-258s1c1
Sequence:CCGGCGCTCCGTGAAATTAGACGTTCTCGAGAACGTCTAATTTCACGGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002107.2-288s1c1
Sequence:CCGGCCACTGAACTTCTGATTCGCACTCGAGTGCGAATCAGAAGTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002107.2-166s1c1
Sequence:CCGGCAGGAAGCAACTGGCTACAAACTCGAGTTTGTAGCCAGTTGCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002107.2-293s1c1
Sequence:CCGGGAACTTCTGATTCGCAAACTTCTCGAGAAGTTTGCGAATCAGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144286    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002107.3-531s1c1
Sequence:CCGGCCACTATGATGGGAAACATTTCTCGAGAAATGTTTCCCATCATAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002107.3-886s1c1
Sequence:CCGGGATGGCAACTAAATGGTGTTTCTCGAGAAACACCATTTAGTTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002107
H3F3A MISSION shRNA Lentiviral Transduction Particles
H3 histone, family 3A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002107.3-738s1c1
Sequence:CCGGGCGGAGACGTAAAGCATTAATCTCGAGATTAATGCTTTACGTCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002107.2-283s1c1
Sequence:CCGGGAAGTCCACTGAACTTCTGATCTCGAGATCAGAAGTTCAGTGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002107.2-301s1c1
Sequence:CCGGGATTCGCAAACTTCCCTTCCACTCGAGTGGAAGGGAAGTTTGCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002107.2-258s1c1
Sequence:CCGGCGCTCCGTGAAATTAGACGTTCTCGAGAACGTCTAATTTCACGGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002107.2-288s1c1
Sequence:CCGGCCACTGAACTTCTGATTCGCACTCGAGTGCGAATCAGAAGTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002107.2-166s1c1
Sequence:CCGGCAGGAAGCAACTGGCTACAAACTCGAGTTTGTAGCCAGTTGCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002107.2-293s1c1
Sequence:CCGGGAACTTCTGATTCGCAAACTTCTCGAGAAGTTTGCGAATCAGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144286    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002107.3-531s1c1
Sequence:CCGGCCACTATGATGGGAAACATTTCTCGAGAAATGTTTCCCATCATAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002107.3-886s1c1
Sequence:CCGGGATGGCAACTAAATGGTGTTTCTCGAGAAACACCATTTAGTTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008210
H3F3A MISSION shRNA Bacterial Glycerol Stock
H3 histone, family 3A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008210.2-740s1c1
Sequence:CCGGCGTTCATTTGTGTGTGAATTTCTCGAGAAATTCACACACAAATGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008210.2-318s1c1
Sequence:CCGGCGCTATCAGAAGTCCACTGAACTCGAGTTCAGTGGACTTCTGATAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008210.2-497s1c1
Sequence:CCGGCCATGCCAAACGTGTAACAATCTCGAGATTGTTACACGTTTGGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008210.2-374s1c1
Sequence:CCGGGCGAGAAATTGCTCAGGACTTCTCGAGAAGTCCTGAGCAATTTCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008210.2-208s1c1
Sequence:CCGGCCAGGAAACAACTGGCTACAACTCGAGTTGTAGCCAGTTGTTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008210.4-548s21c1
Sequence:CCGGTACGCGGAGAACGTGCTTAAGCTCGAGCTTAAGCACGTTCTCCGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008210.4-182s21c1
Sequence:CCGGGCAAATCCACCGGTGGTAAAGCTCGAGCTTTACCACCGGTGGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008210.4-291s21c1
Sequence:CCGGTACTGTGGCCCTCCGTGAAATCTCGAGATTTCACGGAGGGCCACAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008210.4-634s21c1
Sequence:CCGGGTAGTTCTGAATGTTAGATATCTCGAGATATCTAACATTCAGAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008210.4-814s21c1
Sequence:CCGGCATTTCAACAGTTCAACTTTACTCGAGTAAAGTTGAACTGTTGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008210
H3F3A MISSION shRNA shRNA Plasmid DNA
H3 histone, family 3A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008210.2-740s1c1
Sequence:CCGGCGTTCATTTGTGTGTGAATTTCTCGAGAAATTCACACACAAATGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008210.2-318s1c1
Sequence:CCGGCGCTATCAGAAGTCCACTGAACTCGAGTTCAGTGGACTTCTGATAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008210.2-497s1c1
Sequence:CCGGCCATGCCAAACGTGTAACAATCTCGAGATTGTTACACGTTTGGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008210.2-374s1c1
Sequence:CCGGGCGAGAAATTGCTCAGGACTTCTCGAGAAGTCCTGAGCAATTTCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008210.2-208s1c1
Sequence:CCGGCCAGGAAACAACTGGCTACAACTCGAGTTGTAGCCAGTTGTTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008210.4-548s21c1
Sequence:CCGGTACGCGGAGAACGTGCTTAAGCTCGAGCTTAAGCACGTTCTCCGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008210.4-182s21c1
Sequence:CCGGGCAAATCCACCGGTGGTAAAGCTCGAGCTTTACCACCGGTGGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008210.4-291s21c1
Sequence:CCGGTACTGTGGCCCTCCGTGAAATCTCGAGATTTCACGGAGGGCCACAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008210.4-634s21c1
Sequence:CCGGGTAGTTCTGAATGTTAGATATCTCGAGATATCTAACATTCAGAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008210.4-814s21c1
Sequence:CCGGCATTTCAACAGTTCAACTTTACTCGAGTAAAGTTGAACTGTTGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008210
H3F3A MISSION shRNA Lentiviral Transduction Particles
H3 histone, family 3A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008210.2-740s1c1
Sequence:CCGGCGTTCATTTGTGTGTGAATTTCTCGAGAAATTCACACACAAATGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008210.2-318s1c1
Sequence:CCGGCGCTATCAGAAGTCCACTGAACTCGAGTTCAGTGGACTTCTGATAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008210.2-497s1c1
Sequence:CCGGCCATGCCAAACGTGTAACAATCTCGAGATTGTTACACGTTTGGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008210.2-374s1c1
Sequence:CCGGGCGAGAAATTGCTCAGGACTTCTCGAGAAGTCCTGAGCAATTTCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008210.2-208s1c1
Sequence:CCGGCCAGGAAACAACTGGCTACAACTCGAGTTGTAGCCAGTTGTTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008210.4-548s21c1
Sequence:CCGGTACGCGGAGAACGTGCTTAAGCTCGAGCTTAAGCACGTTCTCCGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008210.4-182s21c1
Sequence:CCGGGCAAATCCACCGGTGGTAAAGCTCGAGCTTTACCACCGGTGGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008210.4-291s21c1
Sequence:CCGGTACTGTGGCCCTCCGTGAAATCTCGAGATTTCACGGAGGGCCACAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008210.4-634s21c1
Sequence:CCGGGTAGTTCTGAATGTTAGATATCTCGAGATATCTAACATTCAGAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008210.4-814s21c1
Sequence:CCGGCATTTCAACAGTTCAACTTTACTCGAGTAAAGTTGAACTGTTGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks