EMAIL THIS PAGE TO A FRIEND

HAPLN4

hyaluronan and proteoglycan link protein 4

Synonyms: BRAL2
UniProtKB ID: Q86UW8, A5PKW5, Q96PW2
Gene ID:
Mouse(330790) hyaluronan and proteoglycan link protein 4
Rat(361129) hyaluronan and proteoglycan link protein 4
Zebrafish(559818) hyaluronan and proteoglycan link protein 4
chicken(100858365) hyaluronan and proteoglycan link protein 4
cow(539254) hyaluronan and proteoglycan link protein 4
domestic cat(101091262) hyaluronan and proteoglycan link protein 4
dog(100686618) hyaluronan and proteoglycan link protein 4
sheep(101105570) hyaluronan and proteoglycan link protein 4
domestic guinea pig(100721407) hyaluronan and proteoglycan link protein 4
naked mole-rat(101714652) hyaluronan and proteoglycan link protein 4
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023002 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023002 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023002 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177900 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177900 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177900 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023002 Rosetta Predictions human pricing
NM_001108398 Rosetta Predictions rat pricing
NM_177900 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023002 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014373 predicted 761
2 SASI_Hs01_00014374 predicted 1626
3 SASI_Hs01_00014375 predicted 1637
4 SASI_Hs01_00014376 predicted 1635
5 SASI_Hs01_00014377 predicted 493
6 SASI_Hs01_00014378 predicted 925
7 SASI_Hs01_00014379 predicted 1548
8 SASI_Hs01_00014380 predicted 767
9 SASI_Hs01_00014381 predicted 1710
10 SASI_Hs01_00014382 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108398 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238269 predicted 1717
2 SASI_Rn02_00238270 predicted 354
3 SASI_Rn02_00238271 predicted 1433
4 SASI_Rn02_00238272 predicted 1594
5 SASI_Rn02_00238273 predicted 318
6 SASI_Rn02_00238274 predicted 354
7 SASI_Rn02_00238275 predicted 1658
8 SASI_Rn02_00238276 predicted 1408
9 SASI_Rn02_00238277 predicted 550
10 SASI_Rn02_00238278 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177900 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348380 predicted 802
2 SASI_Mm01_00176830 predicted 549
3 SASI_Mm01_00176831 predicted 305
4 SASI_Mm01_00176833 predicted 1370
5 SASI_Mm01_00176835 predicted 774
6 SASI_Mm01_00176836 predicted 266
7 SASI_Mm01_00176834 predicted 1396
8 SASI_Mm02_00348381 predicted 1535
9 SASI_Mm02_00348382 predicted 1540
10 SASI_Mm01_00176838 predicted 482
11 SASI_Mm01_00176832 predicted 938
12 SASI_Mm01_00176837 predicted 811
13 SASI_Mm01_00176839 predicted 278
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023002
HAPLN4 MISSION shRNA Bacterial Glycerol Stock
hyaluronan and proteoglycan link protein 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164618    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023002.1-2065s1c1
Sequence:CCGGCCGGTAAGATCCATGTCACTACTCGAGTAGTGACATGGATCTTACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164356    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023002.1-3180s1c1
Sequence:CCGGCCCTCTTTACTGTCACGTCATCTCGAGATGACGTGACAGTAAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164211    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023002.1-3232s1c1
Sequence:CCGGCAGGTCGGTTTGGGTTTGAATCTCGAGATTCAAACCCAAACCGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023002.1-449s1c1
Sequence:CCGGGAAGTCACCAATGAGCTGGAACTCGAGTTCCAGCTCATTGGTGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164577    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023002.1-2819s1c1
Sequence:CCGGCGTCGTCCTACAAATGAGGAACTCGAGTTCCTCATTTGTAGGACGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023002.1-439s1c1
Sequence:CCGGCTATGAGTGCGAAGTCACCAACTCGAGTTGGTGACTTCGCACTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159893    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023002.1-2983s1c1
Sequence:CCGGGAGGGATGGAATGTTCTTTAACTCGAGTTAAAGAACATTCCATCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161342    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023002.1-1392s1c1
Sequence:CCGGGCAGAACAGTACTTTGGAGTTCTCGAGAACTCCAAAGTACTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162540    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023002.1-3195s1c1
Sequence:CCGGCGTCATCTCTAGGAAACCTATCTCGAGATAGGTTTCCTAGAGATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023002
HAPLN4 MISSION shRNA shRNA Plasmid DNA
hyaluronan and proteoglycan link protein 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164618    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023002.1-2065s1c1
Sequence:CCGGCCGGTAAGATCCATGTCACTACTCGAGTAGTGACATGGATCTTACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164356    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023002.1-3180s1c1
Sequence:CCGGCCCTCTTTACTGTCACGTCATCTCGAGATGACGTGACAGTAAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164211    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023002.1-3232s1c1
Sequence:CCGGCAGGTCGGTTTGGGTTTGAATCTCGAGATTCAAACCCAAACCGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023002.1-449s1c1
Sequence:CCGGGAAGTCACCAATGAGCTGGAACTCGAGTTCCAGCTCATTGGTGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164577    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023002.1-2819s1c1
Sequence:CCGGCGTCGTCCTACAAATGAGGAACTCGAGTTCCTCATTTGTAGGACGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023002.1-439s1c1
Sequence:CCGGCTATGAGTGCGAAGTCACCAACTCGAGTTGGTGACTTCGCACTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159893    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023002.1-2983s1c1
Sequence:CCGGGAGGGATGGAATGTTCTTTAACTCGAGTTAAAGAACATTCCATCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161342    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023002.1-1392s1c1
Sequence:CCGGGCAGAACAGTACTTTGGAGTTCTCGAGAACTCCAAAGTACTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162540    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023002.1-3195s1c1
Sequence:CCGGCGTCATCTCTAGGAAACCTATCTCGAGATAGGTTTCCTAGAGATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023002
HAPLN4 MISSION shRNA Lentiviral Transduction Particles
hyaluronan and proteoglycan link protein 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164618    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023002.1-2065s1c1
Sequence:CCGGCCGGTAAGATCCATGTCACTACTCGAGTAGTGACATGGATCTTACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164356    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023002.1-3180s1c1
Sequence:CCGGCCCTCTTTACTGTCACGTCATCTCGAGATGACGTGACAGTAAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164211    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023002.1-3232s1c1
Sequence:CCGGCAGGTCGGTTTGGGTTTGAATCTCGAGATTCAAACCCAAACCGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023002.1-449s1c1
Sequence:CCGGGAAGTCACCAATGAGCTGGAACTCGAGTTCCAGCTCATTGGTGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164577    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023002.1-2819s1c1
Sequence:CCGGCGTCGTCCTACAAATGAGGAACTCGAGTTCCTCATTTGTAGGACGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023002.1-439s1c1
Sequence:CCGGCTATGAGTGCGAAGTCACCAACTCGAGTTGGTGACTTCGCACTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159893    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023002.1-2983s1c1
Sequence:CCGGGAGGGATGGAATGTTCTTTAACTCGAGTTAAAGAACATTCCATCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161342    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023002.1-1392s1c1
Sequence:CCGGGCAGAACAGTACTTTGGAGTTCTCGAGAACTCCAAAGTACTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162540    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023002.1-3195s1c1
Sequence:CCGGCGTCATCTCTAGGAAACCTATCTCGAGATAGGTTTCCTAGAGATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177900
HAPLN4 MISSION shRNA Bacterial Glycerol Stock
hyaluronan and proteoglycan link protein 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177900.3-287s1c1
Sequence:CCGGCAAGTGGACGAAAGTGGTAGACTCGAGTCTACCACTTTCGTCCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177900.3-224s1c1
Sequence:CCGGCATTGTCTTACCCTGCCGTTACTCGAGTAACGGCAGGGTAAGACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177900.3-774s1c1
Sequence:CCGGCGCAACTATGGATATCGTCATCTCGAGATGACGATATCCATAGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177900.3-547s1c1
Sequence:CCGGGAGGTCGCTACAAGATGACTTCTCGAGAAGTCATCTTGTAGCGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177900
HAPLN4 MISSION shRNA shRNA Plasmid DNA
hyaluronan and proteoglycan link protein 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177900.3-287s1c1
Sequence:CCGGCAAGTGGACGAAAGTGGTAGACTCGAGTCTACCACTTTCGTCCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177900.3-224s1c1
Sequence:CCGGCATTGTCTTACCCTGCCGTTACTCGAGTAACGGCAGGGTAAGACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177900.3-774s1c1
Sequence:CCGGCGCAACTATGGATATCGTCATCTCGAGATGACGATATCCATAGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177900.3-547s1c1
Sequence:CCGGGAGGTCGCTACAAGATGACTTCTCGAGAAGTCATCTTGTAGCGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177900
HAPLN4 MISSION shRNA Lentiviral Transduction Particles
hyaluronan and proteoglycan link protein 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177900.3-287s1c1
Sequence:CCGGCAAGTGGACGAAAGTGGTAGACTCGAGTCTACCACTTTCGTCCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177900.3-224s1c1
Sequence:CCGGCATTGTCTTACCCTGCCGTTACTCGAGTAACGGCAGGGTAAGACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177900.3-774s1c1
Sequence:CCGGCGCAACTATGGATATCGTCATCTCGAGATGACGATATCCATAGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177900.3-547s1c1
Sequence:CCGGGAGGTCGCTACAAGATGACTTCTCGAGAAGTCATCTTGTAGCGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks