EMAIL THIS PAGE TO A FRIEND

HAUS2

HAUS augmin-like complex, subunit 2

Synonyms: C15orf25 CEP27 HsT17025
UniProtKB ID: Q9NVX0, C9JH36, Q9H9B3
Gene ID:
Human(55142) Summary: HAUS2 is 1 of 8 subunits of the 390-kD human augmin complex, or HAUS complex. The augmin complex was first identified in Drosophila, and its name comes from the Latin verb 'augmentare,' meaning 'to increase.' The augmin complex is a microtubule-binding complex involved in microtubule generation within the mitotic spindle and is vital to mitotic spindle assembly (Goshima et al., 2008 [PubMed 18443220]
Mouse(66296) HAUS augmin-like complex, subunit 2
Rat(679550) HAUS augmin-like complex, subunit 2
chicken(423237) HAUS augmin-like complex, subunit 2
dog(478270) HAUS augmin-like complex, subunit 2
cow(508698) HAUS augmin-like complex, subunit 2
domestic cat(101100645) HAUS augmin-like complex, subunit 2
domestic guinea pig(100713128) HAUS augmin-like complex, subunit 2
naked mole-rat(101712812) HAUS augmin-like complex, subunit 2
sheep(101118615) HAUS augmin-like complex, subunit 2
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025475 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025475 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025475 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018097 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018097 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018097 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018097 Rosetta Predictions human pricing
XM_001053441 Rosetta Predictions rat pricing
NM_025475 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018097 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101146 predicted 522
2 SASI_Hs01_00101147 predicted 753
3 SASI_Hs01_00101149 predicted 376
4 SASI_Hs01_00101150 predicted 434
5 SASI_Hs01_00101151 predicted 534
6 SASI_Hs02_00351280 predicted 522
7 SASI_Hs01_00101152 predicted 715
8 SASI_Hs01_00101153 predicted 759
9 SASI_Hs01_00101154 predicted 802
10 SASI_Hs01_00101155 predicted 688
11 SASI_Hs01_00101148 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053441 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272339 predicted 249
2 SASI_Rn02_00272340 predicted 497
3 SASI_Rn02_00272341 predicted 213
4 SASI_Rn02_00272342 predicted 464
5 SASI_Rn02_00272343 predicted 676
6 SASI_Rn02_00272344 predicted 405
7 SASI_Rn02_00272345 predicted 823
8 SASI_Rn02_00272346 predicted 402
9 SASI_Rn02_00272347 predicted 293
10 SASI_Rn02_00272348 predicted 755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025475 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328336 predicted 719
2 SASI_Mm02_00328337 predicted 281
3 SASI_Mm02_00328338 predicted 393
4 SASI_Mm02_00328339 predicted 236
5 SASI_Mm02_00328340 predicted 202
6 SASI_Mm02_00328341 predicted 658
7 SASI_Mm02_00328342 predicted 584
8 SASI_Mm02_00328343 predicted 378
9 SASI_Mm02_00328344 predicted 513
10 SASI_Mm02_00328345 predicted 507
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025475
VALIDATED
HAUS2 MISSION shRNA Bacterial Glycerol Stock
HAUS augmin-like complex, subunit 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193968    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025475.1-922s1c1
Sequence:CCGGGATCACTGATTCCCACAGATACTCGAGTATCTGTGGGAATCAGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025475.1-516s1c1
Sequence:CCGGGAGCAAAGCTTTAGCCAAGATCTCGAGATCTTGGCTAAAGCTTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025475.1-523s1c1
Sequence:CCGGGCTTTAGCCAAGATGGATATTCTCGAGAATATCCATCTTGGCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025475.2-380s1c1
Sequence:CCGGCTTGCCATTGGAAGCTGTTTACTCGAGTAAACAGCTTCCAATGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025475.2-90s21c1
Sequence:CCGGGCTTCGGGCATAGTCACTAAGCTCGAGCTTAGTGACTATGCCCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025475.2-523s21c1
Sequence:CCGGCTTTAGCCAAGATGGATATTTCTCGAGAAATATCCATCTTGGCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025475.2-59s21c1
Sequence:CCGGTGCAGCTGGGTTACTGCTAAACTCGAGTTTAGCAGTAACCCAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025475.2-2080s21c1
Sequence:CCGGGAAACGGAGTCTTCGTGTAAACTCGAGTTTACACGAAGACTCCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025475.2-459s21c1
Sequence:CCGGACCCATCTTGAAACAGTTAAACTCGAGTTTAACTGTTTCAAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025475
VALIDATED
HAUS2 MISSION shRNA shRNA Plasmid DNA
HAUS augmin-like complex, subunit 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193968    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025475.1-922s1c1
Sequence:CCGGGATCACTGATTCCCACAGATACTCGAGTATCTGTGGGAATCAGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025475.1-516s1c1
Sequence:CCGGGAGCAAAGCTTTAGCCAAGATCTCGAGATCTTGGCTAAAGCTTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025475.1-523s1c1
Sequence:CCGGGCTTTAGCCAAGATGGATATTCTCGAGAATATCCATCTTGGCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025475.2-380s1c1
Sequence:CCGGCTTGCCATTGGAAGCTGTTTACTCGAGTAAACAGCTTCCAATGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025475.2-90s21c1
Sequence:CCGGGCTTCGGGCATAGTCACTAAGCTCGAGCTTAGTGACTATGCCCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025475.2-523s21c1
Sequence:CCGGCTTTAGCCAAGATGGATATTTCTCGAGAAATATCCATCTTGGCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025475.2-59s21c1
Sequence:CCGGTGCAGCTGGGTTACTGCTAAACTCGAGTTTAGCAGTAACCCAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025475.2-2080s21c1
Sequence:CCGGGAAACGGAGTCTTCGTGTAAACTCGAGTTTACACGAAGACTCCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025475.2-459s21c1
Sequence:CCGGACCCATCTTGAAACAGTTAAACTCGAGTTTAACTGTTTCAAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025475
VALIDATED
HAUS2 MISSION shRNA Lentiviral Transduction Particles
HAUS augmin-like complex, subunit 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193968    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025475.1-922s1c1
Sequence:CCGGGATCACTGATTCCCACAGATACTCGAGTATCTGTGGGAATCAGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025475.1-516s1c1
Sequence:CCGGGAGCAAAGCTTTAGCCAAGATCTCGAGATCTTGGCTAAAGCTTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025475.1-523s1c1
Sequence:CCGGGCTTTAGCCAAGATGGATATTCTCGAGAATATCCATCTTGGCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025475.2-380s1c1
Sequence:CCGGCTTGCCATTGGAAGCTGTTTACTCGAGTAAACAGCTTCCAATGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025475.2-90s21c1
Sequence:CCGGGCTTCGGGCATAGTCACTAAGCTCGAGCTTAGTGACTATGCCCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025475.2-523s21c1
Sequence:CCGGCTTTAGCCAAGATGGATATTTCTCGAGAAATATCCATCTTGGCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025475.2-59s21c1
Sequence:CCGGTGCAGCTGGGTTACTGCTAAACTCGAGTTTAGCAGTAACCCAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025475.2-2080s21c1
Sequence:CCGGGAAACGGAGTCTTCGTGTAAACTCGAGTTTACACGAAGACTCCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025475.2-459s21c1
Sequence:CCGGACCCATCTTGAAACAGTTAAACTCGAGTTTAACTGTTTCAAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018097
VALIDATED
HAUS2 MISSION shRNA Bacterial Glycerol Stock
HAUS augmin-like complex, subunit 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018097.1-457s1c1
Sequence:CCGGGAAACCCACCTTGAAACAATTCTCGAGAATTGTTTCAAGGTGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018097.1-211s1c1
Sequence:CCGGCTGGAAATTGAACTCCTGAAACTCGAGTTTCAGGAGTTCAATTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018097.1-241s1c1
Sequence:CCGGGATACAGCAGATGTTGTTCATCTCGAGATGAACAACATCTGCTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150175    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018097.1-780s1c1
Sequence:CCGGGTTGACTGTAACATGGGTATTCTCGAGAATACCCATGTTACAGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018097.1-573s1c1
Sequence:CCGGGAATATACTCAAGTGGCGTAACTCGAGTTACGCCACTTGAGTATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018097.2-207s21c1
Sequence:CCGGACTACAGCAGATCACAAATATCTCGAGATATTTGTGATCTGCTGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018097.2-566s21c1
Sequence:CCGGCTTTAGCAAAGATGGATATATCTCGAGATATATCCATCTTTGCTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018097
VALIDATED
HAUS2 MISSION shRNA shRNA Plasmid DNA
HAUS augmin-like complex, subunit 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018097.1-457s1c1
Sequence:CCGGGAAACCCACCTTGAAACAATTCTCGAGAATTGTTTCAAGGTGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018097.1-211s1c1
Sequence:CCGGCTGGAAATTGAACTCCTGAAACTCGAGTTTCAGGAGTTCAATTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018097.1-241s1c1
Sequence:CCGGGATACAGCAGATGTTGTTCATCTCGAGATGAACAACATCTGCTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150175    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018097.1-780s1c1
Sequence:CCGGGTTGACTGTAACATGGGTATTCTCGAGAATACCCATGTTACAGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018097.1-573s1c1
Sequence:CCGGGAATATACTCAAGTGGCGTAACTCGAGTTACGCCACTTGAGTATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018097.2-207s21c1
Sequence:CCGGACTACAGCAGATCACAAATATCTCGAGATATTTGTGATCTGCTGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018097.2-566s21c1
Sequence:CCGGCTTTAGCAAAGATGGATATATCTCGAGATATATCCATCTTTGCTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018097
VALIDATED
HAUS2 MISSION shRNA Lentiviral Transduction Particles
HAUS augmin-like complex, subunit 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018097.1-457s1c1
Sequence:CCGGGAAACCCACCTTGAAACAATTCTCGAGAATTGTTTCAAGGTGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018097.1-211s1c1
Sequence:CCGGCTGGAAATTGAACTCCTGAAACTCGAGTTTCAGGAGTTCAATTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018097.1-241s1c1
Sequence:CCGGGATACAGCAGATGTTGTTCATCTCGAGATGAACAACATCTGCTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150175    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018097.1-780s1c1
Sequence:CCGGGTTGACTGTAACATGGGTATTCTCGAGAATACCCATGTTACAGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018097.1-573s1c1
Sequence:CCGGGAATATACTCAAGTGGCGTAACTCGAGTTACGCCACTTGAGTATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018097.2-207s21c1
Sequence:CCGGACTACAGCAGATCACAAATATCTCGAGATATTTGTGATCTGCTGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018097.2-566s21c1
Sequence:CCGGCTTTAGCAAAGATGGATATATCTCGAGATATATCCATCTTTGCTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks