EMAIL THIS PAGE TO A FRIEND

HAUS8

HAUS augmin-like complex, subunit 8

Synonyms: DGT4 HICE1 NY-SAR-48
UniProtKB ID: Q9BT25, B4DJA7, C9JBZ4, Q49AC4, Q86WF0, Q96FX3
Gene ID:
Human(93323) Summary: HAUS8 is 1 of 8 subunits of the 390-kD human augmin complex, or HAUS complex. The augmin complex was first identified in Drosophila, and its name comes from the Latin verb 'augmentare,' meaning 'to increase.' The augmin complex is a microtubule-binding complex involved in microtubule generation within the mitotic spindle and is vital to mitotic spindle assembly (Goshima et al., 2008 [PubMed 18443220]
Mouse(76478) 4HAUS augmin-like complex, subunit 8
Rat(290626) HAUS augmin-like complex, subunit 8
domestic guinea pig(100730802) HAUS augmin-like complex, subunit 8
naked mole-rat(101726176) HAUS augmin-like complex, subunit 8
sheep(101114439) HAUS augmin-like complex, subunit 8
chicken(420137) HAUS augmin-like complex, subunit 8
cow(511056) HAUS augmin-like complex, subunit 8
domestic cat(101081788) HAUS augmin-like complex, subunit 8
dog(476677) HAUS augmin-like complex, subunit 8
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029621 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029621 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029621 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001011699 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001011699 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001011699 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011699 Rosetta Predictions human pricing
NM_033417 Rosetta Predictions human pricing
NM_001024971 Rosetta Predictions rat pricing
NM_029621 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011699 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154401 predicted 935
2 SASI_Hs01_00154402 predicted 581
3 SASI_Hs01_00154403 predicted 784
4 SASI_Hs01_00154404 predicted 972
5 SASI_Hs01_00154405 predicted 577
6 SASI_Hs01_00154406 predicted 1014
7 SASI_Hs01_00154407 predicted 570
8 SASI_Hs01_00154408 predicted 633
9 SASI_Hs01_00154409 predicted 564
10 SASI_Hs01_00154410 predicted 561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240172 predicted 934
2 SASI_Hs01_00240173 predicted 589
3 SASI_Hs01_00240174 predicted 782
4 SASI_Hs01_00240175 predicted 979
5 SASI_Hs01_00240176 predicted 588
6 SASI_Hs01_00240177 predicted 1020
7 SASI_Hs01_00240178 predicted 575
8 SASI_Hs01_00240179 predicted 636
9 SASI_Hs01_00240180 predicted 567
10 SASI_Hs01_00240181 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024971 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071194 predicted 455
2 SASI_Rn01_00071195 predicted 250
3 SASI_Rn01_00071196 predicted 1165
4 SASI_Rn01_00071197 predicted 1075
5 SASI_Rn02_00202840 predicted 316
6 SASI_Rn01_00071198 predicted 1078
7 SASI_Rn01_00071200 predicted 1178
8 SASI_Rn01_00071202 predicted 1088
9 SASI_Rn02_00202841 predicted 913
10 SASI_Rn02_00202842 predicted 470
11 SASI_Rn01_00071199 predicted 835
12 SASI_Rn01_00071201 predicted 846
13 SASI_Rn01_00071203 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029621 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186135 predicted 197
2 SASI_Mm01_00186136 predicted 1170
3 SASI_Mm02_00335613 predicted 1166
4 SASI_Mm01_00186137 predicted 351
5 SASI_Mm01_00186138 predicted 249
6 SASI_Mm01_00186139 predicted 587
7 SASI_Mm02_00335614 predicted 1172
8 SASI_Mm01_00186140 predicted 1157
9 SASI_Mm01_00186142 predicted 409
10 SASI_Mm01_00186144 predicted 400
11 SASI_Mm01_00186141 predicted 1142
12 SASI_Mm01_00186143 predicted 1215
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029621
VALIDATED
HAUS8 MISSION shRNA Bacterial Glycerol Stock
HAUS augmin-like complex, subunit 8
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029621.2-538s21c1
Sequence:CCGGGTCTGTGAAGATGGAGAACAACTCGAGTTGTTCTCCATCTTCACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029621.2-318s21c1
Sequence:CCGGTAGAAGGGCATGGCATGAATCCTCGAGGATTCATGCCATGCCCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029621.2-1153s21c1
Sequence:CCGGAGATGCCTGCAGGGATGATAGCTCGAGCTATCATCCCTGCAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029621.2-1177s21c1
Sequence:CCGGCTCTTAGGACAGGATGAATTACTCGAGTAATTCATCCTGTCCTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029621.2-414s1c1
Sequence:CCGGCAGACAAAGCTAAGTCCACATCTCGAGATGTGGACTTAGCTTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029621.2-1258s21c1
Sequence:CCGGGCCTTTCTGCTCATTTATGTTCTCGAGAACATAAATGAGCAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029621.1-177s1c1
Sequence:CCGGGTATCTGCAATATGACAAGAACTCGAGTTCTTGTCATATTGCAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029621.1-1260s1c1
Sequence:CCGGGCCTTTCTGCTCATTTATGTTCTCGAGAACATAAATGAGCAGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029621.1-540s1c1
Sequence:CCGGGTCTGTGAAGATGGAGAACAACTCGAGTTGTTCTCCATCTTCACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196216    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029621.1-1231s1c1
Sequence:CCGGGCCTGTCCTACCTGAGTATTTCTCGAGAAATACTCAGGTAGGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029621.1-1256s1c1
Sequence:CCGGGCTGGCCTTTCTGCTCATTTACTCGAGTAAATGAGCAGAAAGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029621
VALIDATED
HAUS8 MISSION shRNA shRNA Plasmid DNA
HAUS augmin-like complex, subunit 8
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029621.2-538s21c1
Sequence:CCGGGTCTGTGAAGATGGAGAACAACTCGAGTTGTTCTCCATCTTCACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029621.2-318s21c1
Sequence:CCGGTAGAAGGGCATGGCATGAATCCTCGAGGATTCATGCCATGCCCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029621.2-1153s21c1
Sequence:CCGGAGATGCCTGCAGGGATGATAGCTCGAGCTATCATCCCTGCAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029621.2-1177s21c1
Sequence:CCGGCTCTTAGGACAGGATGAATTACTCGAGTAATTCATCCTGTCCTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029621.2-414s1c1
Sequence:CCGGCAGACAAAGCTAAGTCCACATCTCGAGATGTGGACTTAGCTTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029621.2-1258s21c1
Sequence:CCGGGCCTTTCTGCTCATTTATGTTCTCGAGAACATAAATGAGCAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029621.1-177s1c1
Sequence:CCGGGTATCTGCAATATGACAAGAACTCGAGTTCTTGTCATATTGCAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029621.1-1260s1c1
Sequence:CCGGGCCTTTCTGCTCATTTATGTTCTCGAGAACATAAATGAGCAGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029621.1-540s1c1
Sequence:CCGGGTCTGTGAAGATGGAGAACAACTCGAGTTGTTCTCCATCTTCACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196216    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029621.1-1231s1c1
Sequence:CCGGGCCTGTCCTACCTGAGTATTTCTCGAGAAATACTCAGGTAGGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029621.1-1256s1c1
Sequence:CCGGGCTGGCCTTTCTGCTCATTTACTCGAGTAAATGAGCAGAAAGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029621
VALIDATED
HAUS8 MISSION shRNA Lentiviral Transduction Particles
HAUS augmin-like complex, subunit 8
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029621.2-538s21c1
Sequence:CCGGGTCTGTGAAGATGGAGAACAACTCGAGTTGTTCTCCATCTTCACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029621.2-318s21c1
Sequence:CCGGTAGAAGGGCATGGCATGAATCCTCGAGGATTCATGCCATGCCCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029621.2-1153s21c1
Sequence:CCGGAGATGCCTGCAGGGATGATAGCTCGAGCTATCATCCCTGCAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029621.2-1177s21c1
Sequence:CCGGCTCTTAGGACAGGATGAATTACTCGAGTAATTCATCCTGTCCTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029621.2-414s1c1
Sequence:CCGGCAGACAAAGCTAAGTCCACATCTCGAGATGTGGACTTAGCTTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029621.2-1258s21c1
Sequence:CCGGGCCTTTCTGCTCATTTATGTTCTCGAGAACATAAATGAGCAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029621.1-177s1c1
Sequence:CCGGGTATCTGCAATATGACAAGAACTCGAGTTCTTGTCATATTGCAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029621.1-1260s1c1
Sequence:CCGGGCCTTTCTGCTCATTTATGTTCTCGAGAACATAAATGAGCAGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029621.1-540s1c1
Sequence:CCGGGTCTGTGAAGATGGAGAACAACTCGAGTTGTTCTCCATCTTCACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196216    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029621.1-1231s1c1
Sequence:CCGGGCCTGTCCTACCTGAGTATTTCTCGAGAAATACTCAGGTAGGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029621.1-1256s1c1
Sequence:CCGGGCTGGCCTTTCTGCTCATTTACTCGAGTAAATGAGCAGAAAGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001011699
VALIDATED
HAUS8 MISSION shRNA Bacterial Glycerol Stock
HAUS augmin-like complex, subunit 8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001011699.1-1257s21c1
Sequence:CCGGCATCAGCCCAAGCGAAGATTTCTCGAGAAATCTTCGCTTGGGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011699.1-787s21c1
Sequence:CCGGACACGCTTCAAGGAGCAATACCTCGAGGTATTGCTCCTTGAAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001011699.1-968s21c1
Sequence:CCGGATGTGCAGGTGCTGGACTTACCTCGAGGTAAGTCCAGCACCTGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011699.1-574s21c1
Sequence:CCGGCTGACGCTACTATCCGTAAAGCTCGAGCTTTACGGATAGTAGCGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001011699.1-412s21c1
Sequence:CCGGCTGGATCTCTCTGCTATTAATCTCGAGATTAATAGCAGAGAGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001011699
VALIDATED
HAUS8 MISSION shRNA shRNA Plasmid DNA
HAUS augmin-like complex, subunit 8
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001011699.1-1257s21c1
Sequence:CCGGCATCAGCCCAAGCGAAGATTTCTCGAGAAATCTTCGCTTGGGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011699.1-787s21c1
Sequence:CCGGACACGCTTCAAGGAGCAATACCTCGAGGTATTGCTCCTTGAAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001011699.1-968s21c1
Sequence:CCGGATGTGCAGGTGCTGGACTTACCTCGAGGTAAGTCCAGCACCTGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011699.1-574s21c1
Sequence:CCGGCTGACGCTACTATCCGTAAAGCTCGAGCTTTACGGATAGTAGCGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001011699.1-412s21c1
Sequence:CCGGCTGGATCTCTCTGCTATTAATCTCGAGATTAATAGCAGAGAGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001011699
VALIDATED
HAUS8 MISSION shRNA Lentiviral Transduction Particles
HAUS augmin-like complex, subunit 8
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001011699.1-1257s21c1
Sequence:CCGGCATCAGCCCAAGCGAAGATTTCTCGAGAAATCTTCGCTTGGGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011699.1-787s21c1
Sequence:CCGGACACGCTTCAAGGAGCAATACCTCGAGGTATTGCTCCTTGAAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001011699.1-968s21c1
Sequence:CCGGATGTGCAGGTGCTGGACTTACCTCGAGGTAAGTCCAGCACCTGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011699.1-574s21c1
Sequence:CCGGCTGACGCTACTATCCGTAAAGCTCGAGCTTTACGGATAGTAGCGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001011699.1-412s21c1
Sequence:CCGGCTGGATCTCTCTGCTATTAATCTCGAGATTAATAGCAGAGAGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks