EMAIL THIS PAGE TO A FRIEND

HBB

hemoglobin, beta

Synonyms: CD113t-C beta-globin
Gene ID:
Human(3043) Summary: The alpha (HBA) and beta (HBB) loci determine the structure of the 2 types of polypeptide chains in adult hemoglobin, Hb A. The normal adult hemoglobin tetramer consists of two alpha chains and two beta chains. Mutant beta globin causes sickle cell anemia. Absence of beta chain causes beta-zero-thalassemia. Reduced amounts of detectable beta globin causes beta-plus-thalassemia. The order of the genes in the beta-globin cluster is 5'-epsilon -- gamma-G -- gamma-A -- delta -- beta--3'. [provided by RefSeq, Jul 2008]
Mouse(15127) hemoglobin beta chain complex
Rat(24440) hemoglobin, beta
cow(280813) hemoglobin, beta
domestic cat(101098159) hemoglobin, beta
Horse(100054109) hemoglobin, beta
sheep(101105437) hemoglobin subunit beta
sheep(100049064) hemoglobin, beta
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
560510 3-(Diethylamino)propyl isothiocyanate 97% human pricing

Kits

Product # Description Species Add to Cart
 
MAK115 Hemoglobin Assay Kit sufficient for 250 colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000518 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000518 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000518 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU124661 MISSION® esiRNA esiRNA human HBD (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000518 Rosetta Predictions human pricing
NM_033234 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000518 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047431 predicted 242
2 SASI_Hs01_00047432 predicted 370
3 SASI_Hs01_00047430 predicted 391
4 SASI_Hs01_00047434 predicted 305
5 SASI_Hs02_00302709 predicted 391
6 SASI_Hs01_00047433 predicted 395
7 SASI_Hs01_00047435 predicted 294
8 SASI_Hs01_00047436 predicted 585
9 SASI_Hs01_00047437 predicted 492
10 SASI_Hs01_00047438 predicted 496
11 SASI_Hs01_00047439 predicted 490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033234 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265514 predicted 206
2 SASI_Rn02_00265515 predicted 95
3 SASI_Rn02_00265516 predicted 159
4 SASI_Rn02_00265517 predicted 162
5 SASI_Rn02_00265518 predicted 103
6 SASI_Rn01_00063410 predicted 306
7 SASI_Rn01_00063411 predicted 332
8 SASI_Rn01_00063412 predicted 253
9 SASI_Rn01_00063413 predicted 375
10 SASI_Rn01_00063414 predicted 302
11 SASI_Rn01_00063415 predicted 262
12 SASI_Rn01_00063416 predicted 365
13 SASI_Rn01_00063417 predicted 258
14 SASI_Rn01_00063418 predicted 301
15 SASI_Rn01_00063419 predicted 276
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000518
VALIDATED
HBB MISSION shRNA Bacterial Glycerol Stock
hemoglobin, beta
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000518.4-397s1c1
Sequence:CCGGCCCATCACTTTGGCAAAGAATCTCGAGATTCTTTGCCAAAGTGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000518.4-141s1c1
Sequence:CCGGAGGCTGCTGGTGGTCTACCCTCTCGAGAGGGTAGACCACCAGCAGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000518.4-392s1c1
Sequence:CCGGGCTGGCCCATCACTTTGGCAACTCGAGTTGCCAAAGTGATGGGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000518.4-167s1c1
Sequence:CCGGCCAGAGGTTCTTTGAGTCCTTCTCGAGAAGGACTCAAAGAACCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000518.4-298s1c1
Sequence:CCGGAGGGCACCTTTGCCACACTGACTCGAGTCAGTGTGGCAAAGGTGCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000518.4-99s21c1
Sequence:CCGGGGCAAGGTGAACGTGGATGAACTCGAGTTCATCCACGTTCACCTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000518.4-232s21c1
Sequence:CCGGTGAAGGCTCATGGCAAGAAAGCTCGAGCTTTCTTGCCATGAGCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_000518.4-394s21c1
Sequence:CCGGTGGCCCATCACTTTGGCAAAGCTCGAGCTTTGCCAAAGTGATGGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000518.4-160s21c1
Sequence:CCGGCTTGGACCCAGAGGTTCTTTGCTCGAGCAAAGAACCTCTGGGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_000518.4-197s21c1
Sequence:CCGGGTCCACTCCTGATGCTGTTATCTCGAGATAACAGCATCAGGAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000518
VALIDATED
HBB MISSION shRNA shRNA Plasmid DNA
hemoglobin, beta
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000518.4-397s1c1
Sequence:CCGGCCCATCACTTTGGCAAAGAATCTCGAGATTCTTTGCCAAAGTGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000518.4-141s1c1
Sequence:CCGGAGGCTGCTGGTGGTCTACCCTCTCGAGAGGGTAGACCACCAGCAGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000518.4-392s1c1
Sequence:CCGGGCTGGCCCATCACTTTGGCAACTCGAGTTGCCAAAGTGATGGGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000518.4-167s1c1
Sequence:CCGGCCAGAGGTTCTTTGAGTCCTTCTCGAGAAGGACTCAAAGAACCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000518.4-298s1c1
Sequence:CCGGAGGGCACCTTTGCCACACTGACTCGAGTCAGTGTGGCAAAGGTGCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000518.4-99s21c1
Sequence:CCGGGGCAAGGTGAACGTGGATGAACTCGAGTTCATCCACGTTCACCTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000518.4-232s21c1
Sequence:CCGGTGAAGGCTCATGGCAAGAAAGCTCGAGCTTTCTTGCCATGAGCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_000518.4-394s21c1
Sequence:CCGGTGGCCCATCACTTTGGCAAAGCTCGAGCTTTGCCAAAGTGATGGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000518.4-160s21c1
Sequence:CCGGCTTGGACCCAGAGGTTCTTTGCTCGAGCAAAGAACCTCTGGGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_000518.4-197s21c1
Sequence:CCGGGTCCACTCCTGATGCTGTTATCTCGAGATAACAGCATCAGGAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000518
VALIDATED
HBB MISSION shRNA Lentiviral Transduction Particles
hemoglobin, beta
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000518.4-397s1c1
Sequence:CCGGCCCATCACTTTGGCAAAGAATCTCGAGATTCTTTGCCAAAGTGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000518.4-141s1c1
Sequence:CCGGAGGCTGCTGGTGGTCTACCCTCTCGAGAGGGTAGACCACCAGCAGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000518.4-392s1c1
Sequence:CCGGGCTGGCCCATCACTTTGGCAACTCGAGTTGCCAAAGTGATGGGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000518.4-167s1c1
Sequence:CCGGCCAGAGGTTCTTTGAGTCCTTCTCGAGAAGGACTCAAAGAACCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000518.4-298s1c1
Sequence:CCGGAGGGCACCTTTGCCACACTGACTCGAGTCAGTGTGGCAAAGGTGCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000518.4-99s21c1
Sequence:CCGGGGCAAGGTGAACGTGGATGAACTCGAGTTCATCCACGTTCACCTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000518.4-232s21c1
Sequence:CCGGTGAAGGCTCATGGCAAGAAAGCTCGAGCTTTCTTGCCATGAGCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_000518.4-394s21c1
Sequence:CCGGTGGCCCATCACTTTGGCAAAGCTCGAGCTTTGCCAAAGTGATGGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000518.4-160s21c1
Sequence:CCGGCTTGGACCCAGAGGTTCTTTGCTCGAGCAAAGAACCTCTGGGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_000518.4-197s21c1
Sequence:CCGGGTCCACTCCTGATGCTGTTATCTCGAGATAACAGCATCAGGAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks