EMAIL THIS PAGE TO A FRIEND

HBE1

hemoglobin, epsilon 1

Synonyms: HBE
UniProtKB ID: P02100, Q6FH44
Gene ID:
Human(3046) Summary: The epsilon globin gene (HBE) is normally expressed in the embryonic yolk sac: two epsilon chains together with two zeta chains (an alpha-like globin) constitute the embryonic hemoglobin Hb Gower I; two epsilon chains together with two alpha chains form the embryonic Hb Gower II. Both of these embryonic hemoglobins are normally supplanted by fetal, and later, adult hemoglobin. The five beta-like globin genes are found within a 45 kb cluster on chromosome 11 in the following order: 5'-epsilon - G-gamma - A-gamma - delta - beta-3' [provided by RefSeq, Jul 2008]
Rat(293267) hemoglobin, epsilon 1
chicken(428114) hemoglobin, epsilon 1
dog(485255) hemoglobin, epsilon 1
domestic cat(101091809) hemoglobin, epsilon 1
cow(539994) hemoglobin, epsilon 1
domestic guinea pig(100720679) hemoglobin, epsilon 1
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305948 ANTI-HBE1 (CENTER) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

Proteins

Product # Description Species Add to Cart
 
H7379 Hemoglobin human lyophilized powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005330 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005330 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005330 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU227061 MISSION® esiRNA esiRNA targeting human HBE1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005330 Rosetta Predictions human pricing
NM_001008890 Rosetta Predictions rat pricing
XM_579276 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339397 predicted 568
2 SASI_Hs01_00132719 predicted 570
3 SASI_Hs01_00132720 predicted 339
4 SASI_Hs01_00132721 predicted 286
5 SASI_Hs01_00132722 predicted 506
6 SASI_Hs01_00132723 predicted 495
7 SASI_Hs01_00132724 predicted 388
8 SASI_Hs01_00132726 predicted 566
9 SASI_Hs01_00132727 predicted 487
10 SASI_Hs01_00132728 predicted 570
11 SASI_Hs01_00132725 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008890 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096846 predicted 223
2 SASI_Rn01_00096847 predicted 215
3 SASI_Rn01_00096848 predicted 337
4 SASI_Rn01_00096850 predicted 83
5 SASI_Rn01_00096851 predicted 37
6 SASI_Rn01_00096852 predicted 22
7 SASI_Rn01_00096853 predicted 330
8 SASI_Rn01_00096854 predicted 271
9 SASI_Rn02_00199447 predicted 298
10 SASI_Rn02_00199448 predicted 30
11 SASI_Rn01_00096849 predicted 177
12 SASI_Rn01_00096855 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579276 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00131286 predicted 225
2 SASI_Rn01_00131287 predicted 219
3 SASI_Rn01_00131288 predicted 344
4 SASI_Rn01_00131289 predicted 174
5 SASI_Rn01_00131290 predicted 92
6 SASI_Rn01_00131291 predicted 52
7 SASI_Rn01_00131292 predicted 34
8 SASI_Rn01_00131293 predicted 330
9 SASI_Rn01_00131294 predicted 285
10 SASI_Rn01_00131295 predicted 345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005330
HBE1 MISSION shRNA Bacterial Glycerol Stock
hemoglobin, epsilon 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005330.3-289s21c1
Sequence:CCGGCACTAGCCTGTGGAGCAAGATCTCGAGATCTTGCTCCACAGGCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005330.3-670s21c1
Sequence:CCGGCATTGCCCTGGCCCATAAGTACTCGAGTACTTATGGGCCAGGGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005330.3-387s21c1
Sequence:CCGGGCTTTGGAAACCTGTCGTCTCCTCGAGGAGACGACAGGTTTCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005330.3-572s1c1
Sequence:CCGGCTGGGTAACGTGATGGTGATTCTCGAGAATCACCATCACGTTACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005330.3-600s1c1
Sequence:CCGGCTACTCACTTTGGCAAGGAGTCTCGAGACTCCTTGCCAAAGTGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005330.3-339s1c1
Sequence:CCGGTGGGCAGACTCCTCGTTGTTTCTCGAGAAACAACGAGGAGTCTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005330.3-462s1c1
Sequence:CCGGCTTCCTTTGGAGATGCTATTACTCGAGTAATAGCATCTCCAAAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005330.3-582s1c1
Sequence:CCGGTGATGGTGATTATTCTGGCTACTCGAGTAGCCAGAATAATCACCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005330
HBE1 MISSION shRNA shRNA Plasmid DNA
hemoglobin, epsilon 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005330.3-289s21c1
Sequence:CCGGCACTAGCCTGTGGAGCAAGATCTCGAGATCTTGCTCCACAGGCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005330.3-670s21c1
Sequence:CCGGCATTGCCCTGGCCCATAAGTACTCGAGTACTTATGGGCCAGGGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005330.3-387s21c1
Sequence:CCGGGCTTTGGAAACCTGTCGTCTCCTCGAGGAGACGACAGGTTTCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005330.3-572s1c1
Sequence:CCGGCTGGGTAACGTGATGGTGATTCTCGAGAATCACCATCACGTTACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005330.3-600s1c1
Sequence:CCGGCTACTCACTTTGGCAAGGAGTCTCGAGACTCCTTGCCAAAGTGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005330.3-339s1c1
Sequence:CCGGTGGGCAGACTCCTCGTTGTTTCTCGAGAAACAACGAGGAGTCTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005330.3-462s1c1
Sequence:CCGGCTTCCTTTGGAGATGCTATTACTCGAGTAATAGCATCTCCAAAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005330.3-582s1c1
Sequence:CCGGTGATGGTGATTATTCTGGCTACTCGAGTAGCCAGAATAATCACCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005330
HBE1 MISSION shRNA Lentiviral Transduction Particles
hemoglobin, epsilon 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005330.3-289s21c1
Sequence:CCGGCACTAGCCTGTGGAGCAAGATCTCGAGATCTTGCTCCACAGGCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005330.3-670s21c1
Sequence:CCGGCATTGCCCTGGCCCATAAGTACTCGAGTACTTATGGGCCAGGGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005330.3-387s21c1
Sequence:CCGGGCTTTGGAAACCTGTCGTCTCCTCGAGGAGACGACAGGTTTCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005330.3-572s1c1
Sequence:CCGGCTGGGTAACGTGATGGTGATTCTCGAGAATCACCATCACGTTACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005330.3-600s1c1
Sequence:CCGGCTACTCACTTTGGCAAGGAGTCTCGAGACTCCTTGCCAAAGTGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005330.3-339s1c1
Sequence:CCGGTGGGCAGACTCCTCGTTGTTTCTCGAGAAACAACGAGGAGTCTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005330.3-462s1c1
Sequence:CCGGCTTCCTTTGGAGATGCTATTACTCGAGTAATAGCATCTCCAAAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005330.3-582s1c1
Sequence:CCGGTGATGGTGATTATTCTGGCTACTCGAGTAGCCAGAATAATCACCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks