EMAIL THIS PAGE TO A FRIEND

HBG1

hemoglobin, gamma A

Synonyms: HBGA HBGR HSGGL1
UniProtKB ID: P69891, P02096, P62027, Q549G1, Q8TDA1, Q96FH7
Gene ID:
Human(3047) Summary: The gamma globin genes (HBG1 and HBG2) are normally expressed in the fetal liver, spleen and bone marrow. Two gamma chains together with two alpha chains constitute fetal hemoglobin (HbF) which is normally replaced by adult hemoglobin (HbA) at birth. In some beta-thalassemias and related conditions, gamma chain production continues into adulthood. The two types of gamma chains differ at residue 136 where glycine is found in the G-gamma product (HBG2) and alanine is found in the A-gamma product (HBG1). The former is predominant at birth. The order of the genes in the beta-globin cluster is: 5'-epsilon -- gamma-G -- gamma-A -- delta -- beta--3'. [provided by RefSeq, Jul 2008]
Rat(94164) hemoglobin, gamma A
chicken(419079) hemoglobin, gamma A
Domestic Rabbit(100328859) hemoglobin, gamma A
39 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Proteins

Product # Description Species Add to Cart
 
H7379 Hemoglobin human lyophilized powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000559 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000559 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000559 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU230241 MISSION® esiRNA esiRNA targeting human HBG1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000559 Rosetta Predictions human pricing
NM_172093 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000559 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077122 predicted 270
2 SASI_Hs01_00077123 predicted 296
3 SASI_Hs01_00077124 predicted 269
4 SASI_Hs01_00077126 predicted 269
5 SASI_Hs02_00302802 predicted 190
6 SASI_Hs01_00077128 predicted 136
7 SASI_Hs01_00077129 predicted 77
8 SASI_Hs02_00302803 predicted 511
9 SASI_Hs01_00077130 predicted 390
10 SASI_Hs02_00302804 predicted 535
11 SASI_Hs01_00077125 predicted 204
12 SASI_Hs01_00077127 predicted 174
13 SASI_Hs01_00077131 predicted 72
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172093 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121466 predicted 202
2 SASI_Rn01_00121467 predicted 207
3 SASI_Rn01_00121468 predicted 201
4 SASI_Rn01_00121469 predicted 204
5 SASI_Rn01_00121470 predicted 199
6 SASI_Rn01_00121471 predicted 210
7 SASI_Rn01_00121474 predicted 316
8 SASI_Rn02_00269191 predicted 89
9 SASI_Rn02_00269192 predicted 326
10 SASI_Rn02_00269193 predicted 95
11 SASI_Rn01_00121465 predicted 228
12 SASI_Rn01_00121472 predicted 182
13 SASI_Rn01_00121473 predicted 247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000559
HBG1 MISSION shRNA Bacterial Glycerol Stock
hemoglobin, gamma A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000559.2-308s21c1
Sequence:CCGGCTTTGCCCAGCTGAGTGAACTCTCGAGAGTTCACTCAGCTGGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000559.2-397s21c1
Sequence:CCGGTGGCAATCCATTTCGGCAAAGCTCGAGCTTTGCCGAAATGGATTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000559.2-434s1c1
Sequence:CCGGGCAGGCTTCCTGGCAGAAGATCTCGAGATCTTCTGCCAGGAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000559.2-344s1c1
Sequence:CCGGGCATGTGGATCCTGAGAACTTCTCGAGAAGTTCTCAGGATCCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000559.2-230s1c1
Sequence:CCGGCAAAGTCAAGGCACATGGCAACTCGAGTTGCCATGTGCCTTGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000559.2-176s1c1
Sequence:CCGGGTTCTTTGACAGCTTTGGCAACTCGAGTTGCCAAAGCTGTCAAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000559.2-276s1c1
Sequence:CCGGGCCACAAAGCACCTGGATGATCTCGAGATCATCCAGGTGCTTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000559
HBG1 MISSION shRNA shRNA Plasmid DNA
hemoglobin, gamma A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000559.2-308s21c1
Sequence:CCGGCTTTGCCCAGCTGAGTGAACTCTCGAGAGTTCACTCAGCTGGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000559.2-397s21c1
Sequence:CCGGTGGCAATCCATTTCGGCAAAGCTCGAGCTTTGCCGAAATGGATTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000559.2-434s1c1
Sequence:CCGGGCAGGCTTCCTGGCAGAAGATCTCGAGATCTTCTGCCAGGAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000559.2-344s1c1
Sequence:CCGGGCATGTGGATCCTGAGAACTTCTCGAGAAGTTCTCAGGATCCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000559.2-230s1c1
Sequence:CCGGCAAAGTCAAGGCACATGGCAACTCGAGTTGCCATGTGCCTTGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000559.2-176s1c1
Sequence:CCGGGTTCTTTGACAGCTTTGGCAACTCGAGTTGCCAAAGCTGTCAAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000559.2-276s1c1
Sequence:CCGGGCCACAAAGCACCTGGATGATCTCGAGATCATCCAGGTGCTTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000559
HBG1 MISSION shRNA Lentiviral Transduction Particles
hemoglobin, gamma A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000559.2-308s21c1
Sequence:CCGGCTTTGCCCAGCTGAGTGAACTCTCGAGAGTTCACTCAGCTGGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000559.2-397s21c1
Sequence:CCGGTGGCAATCCATTTCGGCAAAGCTCGAGCTTTGCCGAAATGGATTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000559.2-434s1c1
Sequence:CCGGGCAGGCTTCCTGGCAGAAGATCTCGAGATCTTCTGCCAGGAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000559.2-344s1c1
Sequence:CCGGGCATGTGGATCCTGAGAACTTCTCGAGAAGTTCTCAGGATCCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000559.2-230s1c1
Sequence:CCGGCAAAGTCAAGGCACATGGCAACTCGAGTTGCCATGTGCCTTGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000559.2-176s1c1
Sequence:CCGGGTTCTTTGACAGCTTTGGCAACTCGAGTTGCCAAAGCTGTCAAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000559.2-276s1c1
Sequence:CCGGGCCACAAAGCACCTGGATGATCTCGAGATCATCCAGGTGCTTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks